Transcript: Human NM_001258421.2

Homo sapiens zinc finger FYVE-type containing 19 (ZFYVE19), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
ZFYVE19 (84936)
Length:
2578
CDS:
830..1720

Additional Resources:

NCBI RefSeq record:
NM_001258421.2
NBCI Gene record:
ZFYVE19 (84936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258421.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073144 GCTATCGATGAAAGCTGGAAA pLKO.1 1097 CDS 100% 4.950 6.930 N ZFYVE19 n/a
2 TRCN0000241293 GGTCACCACCTCAGAACTATA pLKO_005 732 5UTR 100% 13.200 10.560 N Zfyve19 n/a
3 TRCN0000073147 ACACGACAAGACCAGATGATT pLKO.1 815 5UTR 100% 5.625 3.938 N ZFYVE19 n/a
4 TRCN0000073143 GTCCCTGGAATGAGGAAAGAT pLKO.1 1854 3UTR 100% 5.625 3.938 N ZFYVE19 n/a
5 TRCN0000073146 GACACGACAAGACCAGATGAT pLKO.1 814 5UTR 100% 4.950 3.465 N ZFYVE19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258421.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12885 pDONR223 100% 74.6% 74.4% None 0_1ins300;601T>G n/a
2 ccsbBroad304_12885 pLX_304 0% 74.6% 74.4% V5 0_1ins300;601T>G n/a
3 TRCN0000480977 CAGAGCAGTTTGACATGTTAGTAC pLX_317 32.1% 74.6% 74.4% V5 0_1ins300;601T>G n/a
4 ccsbBroadEn_16049 pDONR223 0% 57.4% 57.3% None 0_1ins300;300_503del;601T>G n/a
5 ccsbBroad304_16049 pLX_304 0% 57.4% 57.3% V5 0_1ins300;300_503del;601T>G n/a
6 TRCN0000479582 ACGGCACGTCTACTGCGTGGCGTG pLX_317 33% 57.4% 57.3% V5 0_1ins300;300_503del;601T>G n/a
Download CSV