Construct: ORF TRCN0000479682
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005530.1_s317c1
- Derived from:
- ccsbBroadEn_04412
- DNA Barcode:
- CCGGGATTAGTAGTGCCCAGAATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USP32 (84669)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479682
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 84669 | USP32 | ubiquitin specific peptidas... | NM_032582.4 | 24% | 23.8% | (many diffs) |
2 | human | 84669 | USP32 | ubiquitin specific peptidas... | XM_011525373.1 | 23.8% | 23.6% | (many diffs) |
3 | human | 84669 | USP32 | ubiquitin specific peptidas... | XM_011525376.1 | 23.4% | 22.7% | (many diffs) |
4 | human | 84669 | USP32 | ubiquitin specific peptidas... | XM_011525372.1 | 23.4% | 22.5% | (many diffs) |
5 | human | 84669 | USP32 | ubiquitin specific peptidas... | XM_011525374.1 | 23.2% | 22.5% | (many diffs) |
6 | human | 84669 | USP32 | ubiquitin specific peptidas... | XM_011525371.1 | 23.2% | 22.3% | (many diffs) |
7 | human | 84669 | USP32 | ubiquitin specific peptidas... | XM_011525375.1 | 23% | 22.6% | (many diffs) |
8 | human | 84669 | USP32 | ubiquitin specific peptidas... | XM_017025233.1 | 20.9% | 19.9% | (many diffs) |
9 | human | 84669 | USP32 | ubiquitin specific peptidas... | XM_011525378.1 | 20.7% | 19.8% | (many diffs) |
10 | mouse | 237898 | Usp32 | ubiquitin specific peptidas... | XM_011248991.1 | 39.2% | 41% | (many diffs) |
11 | mouse | 237898 | Usp32 | ubiquitin specific peptidas... | NM_001029934.1 | 22.3% | 23.3% | (many diffs) |
12 | mouse | 237898 | Usp32 | ubiquitin specific peptidas... | XM_011248990.1 | 22.1% | 23.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1236
- ORF length:
- 1170
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tgccaaggag tcacggatcg gattcctcag ctacgaggag gcgctgagga 121 gagttacaga tgtagagcta aaacgactga aggatgcttt caagaggacc tgtggactct 181 catattacat gggccagcac tgcttcatcc gggaagtgct tggggatgga gtgcctccaa 241 aggttgctga ggtgatttac tgttcttttg gtggaacatc caaagggctg cacttcaata 301 atttaatagt tggacttgtc ctccttacaa gaggcaaaga tgaagagaaa gcaaaataca 361 tttttagtct tttttcaagt gaatctggga actatgttat acgggaagaa atggaaagaa 421 tgctccacgt ggtggatggt aaagtcccag atacactcag gaagtgtttc tcagagggtg 481 aaaaggtaaa ctatgaaaag tttagaaatt ggctttttct aaacaaagat gcttttactt 541 tctctcgatg gcttctatct ggaggtgtgt atgttaccct cactgatgat agtgatactc 601 ctactttcta ccaaactctg gctggagtca cacatttgga ggaatcagac atcattgatc 661 ttgagaaacg ctattggtta ttgaaggctc aatcccggac tggacgattt gatttagaga 721 catttggccc attggtttca ccacctattc gtccatctct aagtgaaggt ttgtttaatg 781 cttttgatga aaatcgtgac aatcacatag attttaagga gatatcctgt gggttatcag 841 cctgttgcag gggacccctg gctgaaagac aaaaattttg cttcaaggta tttGATGTTG 901 ACCGTGATGG AGTTCTCTCC AGGGTTGAAC TGAGAGACAT GGTGGTTGCA CTTTTAGAAG 961 TCTGGAAGGA CAACCGCACT GATGATATTC CTGAATTACA TATGGATCTC TCTGATATTG 1021 TAGAAGGCAT ACTGAATGCA CATGACACCA CAAAGATGGG TCATCTTACT CTGGAAGACT 1081 ATCAGATCTG GAGTGTGAAA AATGTTCTTG CCAATGAGTT TTTGAACCTC CTTTTCCAGG 1141 TGTGTCACAT AGTTCTGGGG TTAAGACCAG CTACTCCGGA AGAAGAAGGA CAAATTATTA 1201 GGACTCTGGA AACTGACCAA ATATATACAA GAAATTGCCC AACTTTCTTG TACAAAGTGG 1261 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1321 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1381 ACCGGGATTA GTAGTGCCCA GAATTACGCG TTAAGTCgac aatcaacctc tggattacaa 1441 aatttgtgaa agatt