Transcript: Mouse NM_001029934.1

Mus musculus ubiquitin specific peptidase 32 (Usp32), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Usp32 (237898)
Length:
6978
CDS:
188..5002

Additional Resources:

NCBI RefSeq record:
NM_001029934.1
NBCI Gene record:
Usp32 (237898)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030843 GCTATCAAACATCACAGGAAA pLKO.1 3807 CDS 100% 4.950 6.930 N Usp32 n/a
2 TRCN0000030842 GCAGCATAACACTTCTGACAA pLKO.1 1666 CDS 100% 4.950 3.960 N Usp32 n/a
3 TRCN0000030839 CCCAACTCTTTGCCAGCATAA pLKO.1 4135 CDS 100% 10.800 7.560 N Usp32 n/a
4 TRCN0000030840 CCAGTAATCAAGAATAGCAAA pLKO.1 1934 CDS 100% 4.950 3.465 N Usp32 n/a
5 TRCN0000011127 GCACTGATGATATTCCTGAAT pLKO.1 1098 CDS 100% 4.950 3.465 N USP32 n/a
6 TRCN0000030841 GCAGTCCAATTCAAACAGATT pLKO.1 3207 CDS 100% 4.950 3.465 N Usp32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492225 TATACGCCTCCTCACCATAAATTC pLX_317 8% 91% 95.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488115 GTCATCACGCGGCCGTTATCCCAT pLX_317 7.3% 91% 95.7% V5 (many diffs) n/a
3 ccsbBroadEn_04412 pDONR223 100% 22.3% 23.3% None (many diffs) n/a
4 ccsbBroad304_04412 pLX_304 0% 22.3% 23.3% V5 (many diffs) n/a
5 TRCN0000479682 CCGGGATTAGTAGTGCCCAGAATT pLX_317 29.6% 22.3% 23.3% V5 (many diffs) n/a
6 ccsbBroadEn_13327 pDONR223 100% 3.9% 3.4% None (many diffs) n/a
7 ccsbBroad304_13327 pLX_304 0% 3.9% 3.4% V5 (many diffs) n/a
8 TRCN0000476448 GTATAATACAGCTCGGATCTAGCC pLX_317 100% 3.9% 3.4% V5 (many diffs) n/a
Download CSV