Construct: ORF TRCN0000479734
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008666.1_s317c1
- Derived from:
- ccsbBroadEn_06593
- DNA Barcode:
- CCAGCTATCTAGTAGCCAATTCGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CD200 (4345)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479734
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4345 | CD200 | CD200 molecule | NM_005944.7 | 99.8% | 99.6% | 32C>G |
2 | human | 4345 | CD200 | CD200 molecule | NM_001365852.1 | 97.2% | 97% | 0_1ins21;11C>G |
3 | human | 4345 | CD200 | CD200 molecule | NM_001365853.1 | 97.2% | 97% | 0_1ins21;11C>G |
4 | human | 4345 | CD200 | CD200 molecule | NM_001365854.1 | 97.2% | 97% | 0_1ins21;11C>G |
5 | human | 4345 | CD200 | CD200 molecule | NM_001365851.2 | 96.5% | 95.6% | (many diffs) |
6 | human | 4345 | CD200 | CD200 molecule | NM_001004196.3 | 91.3% | 91.1% | 12_86del;107C>G |
7 | human | 4345 | CD200 | CD200 molecule | NM_001318828.1 | 72.4% | 72.4% | 0_1ins222 |
8 | human | 4345 | CD200 | CD200 molecule | NM_001318826.1 | 56.8% | 45.5% | 0_1ins343;77_78insGTACA |
9 | human | 4345 | CD200 | CD200 molecule | NM_001318830.1 | 56.8% | 45.5% | 0_1ins343;77_78insGTACA |
10 | human | 4345 | CD200 | CD200 molecule | NM_001365855.1 | 56.8% | 45.5% | 0_1ins343;77_78insGTACA |
11 | human | 4345 | CD200 | CD200 molecule | NR_158642.1 | 36.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 873
- ORF length:
- 807
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaggctggtg atcaggatgc ccttctgtca tctgtctacc tacagcctgg 121 tttgggtcat ggcagcagtg gtgctgtgca cagcacaagt gcaagtggtg acccaggatg 181 aaagagagca gctgtacaca cctgcttcct taaaatgctc tctgcaaaat gcccaggaag 241 ccctcattgt gacatggcag aaaaagaaag ctgtaagccc agaaaacatg gtcaccttca 301 gcgagaacca tggggtggtg atccagcctg cctataagga caagataaac attacccagc 361 tgggactcca aaactcaacc atcaccttct ggaatatcac cctggaggat gaagggtgtt 421 acatgtgtct cttcaatacc tttggttttg ggaagatcTC AGGAACGGCC TGCCTCACCG 481 TCTATGTACA GCCCATAGTA TCCCTTCACT ACAAATTCTC TGAAGACCAC CTAAATATCA 541 CTTGCTCTGC CACTGCCCGC CCAGCCCCCA TGGTCTTCTG GAAGGTCCCT CGGTCAGGGA 601 TTGAAAATAG TACAGTGACT CTGTCTCACC CAAATGGGAC CACGTCTGTT ACCAGCATCC 661 TCCATATCAA AGACCCTAAG AATCAGGTGG GGAAGGAGGT GATCTGCCAG GTGCTGCACC 721 TGGGGACTGT GACCGACTTT AAGCAAACCG TCAACAAAGG CTATTGGTTT TCAGTTCCGC 781 TATTGCTAAG CATTGTTTCC CTGGTAATTC TTCTCGTCCT AATCTCAATC TTACTGTACT 841 GGAAACGTCA CCGGAATCAG GACCGAGAGC CCTACCCAAC TTTCTTGTAC AAAGTGGTTG 901 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 961 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACC 1021 AGCTATCTAG TAGCCAATTC GAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1081 ttgtgaaaga tt