Transcript: Human NM_001318828.1

Homo sapiens CD200 molecule (CD200), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
CD200 (4345)
Length:
2266
CDS:
407..994

Additional Resources:

NCBI RefSeq record:
NM_001318828.1
NBCI Gene record:
CD200 (4345)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057464 GCCCATAGTATCCCTTCACTA pLKO.1 610 CDS 100% 4.950 6.930 N CD200 n/a
2 TRCN0000419472 GTCTGTTGTAGGACTTGATTT pLKO_005 1200 3UTR 100% 13.200 10.560 N CD200 n/a
3 TRCN0000419480 GCACTGGACTTAGTTAGTATC pLKO_005 1254 3UTR 100% 10.800 8.640 N CD200 n/a
4 TRCN0000426170 GGACCTCTGTTAGTCACTTTA pLKO_005 1318 3UTR 100% 13.200 9.240 N CD200 n/a
5 TRCN0000057466 CCTGCCTATAAGGACAAGATA pLKO.1 446 CDS 100% 5.625 3.938 N CD200 n/a
6 TRCN0000057465 CGCTATTGCTAAGCATTGTTT pLKO.1 897 CDS 100% 5.625 3.938 N CD200 n/a
7 TRCN0000057463 CCTTGCTAGAATCCTTGGTTT pLKO.1 1604 3UTR 100% 4.950 3.465 N CD200 n/a
8 TRCN0000057467 CCTCCATATCAAAGACCCTAA pLKO.1 778 CDS 100% 4.050 2.835 N CD200 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318828.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06593 pDONR223 100% 72.4% 72.4% None 0_1ins222 n/a
2 ccsbBroad304_06593 pLX_304 0% 72.4% 72.4% V5 0_1ins222 n/a
3 TRCN0000479734 CCAGCTATCTAGTAGCCAATTCGA pLX_317 51.3% 72.4% 72.4% V5 0_1ins222 n/a
Download CSV