Construct: ORF TRCN0000479810
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016712.1_s317c1
- Derived from:
- ccsbBroadEn_11053
- DNA Barcode:
- ACATCTGCGCCTCCCTGGCATATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PRH1 (5554)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479810
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5554 | PRH1 | proline rich protein HaeIII... | NM_001291314.2 | 100% | 100% | |
| 2 | human | 5554 | PRH1 | proline rich protein HaeIII... | NM_001291315.2 | 89.2% | 84% | (many diffs) |
| 3 | human | 5555 | PRH2 | proline rich protein HaeIII... | NM_001110213.1 | 87.3% | 87.1% | (many diffs) |
| 4 | human | 100533464 | PRH1-PRR4 | PRH1-PRR4 readthrough | NR_037918.2 | 34.1% | 1_602del;1164_1645del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 627
- ORF length:
- 561
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct tctgattctg ctgtcagtgg ccctgctggc cttcagctca gctcaggatt 121 taaatgaaga tgtcagccag gaagatgttc ccctcgtaat atcagatgga ggagactctg 181 agcagttcct agatgaggag cgtcagggac cacctttggg aggacagcaa tctcaaccct 241 ctgctggtga tgggaaccag gatgatggcc ctcagcaggg accaccccaa caaggaggcc 301 agcagcaaca aggtccacca cctccTCAGG GAAAGCCACA AGGACCACCC CAACAAGGAG 361 GCCAGCAGCA ACAAGGTCCA CCACCTCCTC AGGGAAAGCC ACAAGGACCA CCCCAACAGG 421 GAGGCCATCC CCCTCCTCCT CAAGGAAGGC CACAAGGACC ACCCCAACAG GGAGGCCATC 481 CCCGTCCTCC TCGAGGAAGG CCACAAGGAC CACCCCAACA GGGAGGCCAT CAGCAAGGTC 541 CTCCCCCACC TCCTCCTGGA AAGCCCCAGG GACCACCTCC CCAAGGGGGC CGCCCACAAG 601 GACCTCCACA GGGGCAGTCT CCTCAGTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 661 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 721 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAACATCTGC 781 GCCTCCCTGG CATATTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 841 aagatt