Construct: ORF TRCN0000479842
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012042.1_s317c1
- Derived from:
- ccsbBroadEn_11506
- DNA Barcode:
- GTGGGGATGAATTGAGCGAAATAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRC41 (10489)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479842
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10489 | LRRC41 | leucine rich repeat contain... | NM_006369.4 | 69.4% | 69.4% | 1_744del |
| 2 | human | 10489 | LRRC41 | leucine rich repeat contain... | XR_002957992.1 | 52.7% | 1_814del;2213_2446del;2741_3208del | |
| 3 | human | 10489 | LRRC41 | leucine rich repeat contain... | XR_002957994.1 | 43.2% | (many diffs) | |
| 4 | mouse | 230654 | Lrrc41 | leucine rich repeat contain... | NM_153521.2 | 61.4% | 65.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1758
- ORF length:
- 1692
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag tgctggcttc tggcaaccag ggcctggtgg cccaccctgc cgcctctgtg 121 gagaggcctc ccgaggccgg gccccatccc gagatgaagg gtccctctta ttgggctcac 181 gtcggccccg ccgggatgct gctgagcgat gtgctgcagc cctgatggcc agccggcgta 241 agagtgaagc caagcagatg cccagagctg cacctgccac tcgggtaaca cgccggagca 301 cacaggagag cctgacagca ggcggaacag accttaagag ggagctgcac cccccagcca 361 cctcccatga ggctcctggc accaagcggt caccttctgc tccagcagcc acctcctctg 421 cctcttcttc tacatcctca tacaaacggg caccagctag ctcagcccca cagcctaagc 481 ccctaaagcg tttcaagcga gctgcaggga agaagggtgc tcgcacccgt caggggcctg 541 gtgcagagtc tgaagacctg tatgacttcg tttttattgt ggctggcgag aaggaggatg 601 gcgaagagat ggagattggg gaagtggctt gtggagcttt ggatggatca gatcccagct 661 gcctggggct tccagcactg gaagcttcac aaagattccg cagcatctcc accttggagc 721 tattcacagt tccactctcc acagaggcag ccctgacact atgccacctg ctgagctcct 781 gggtgtcact ggagagcctc acactctcct acaatggcct gggctctaac atcttccgcc 841 tgctagacag cctgcgggcc ctgtcaggcc aggctggatg tcgcctccgt gccctgcatc 901 tcagtgacct gttctcacca ctgcccatcc tggagctgac acgtgctatc gtgcgagcac 961 tgcccctgct acgggtcctc tctattcgtg ttgaccaccc aagccagcgg gacaaccctg 1021 gtgtgccagg gaatgcaggg ccccctagcc acataatagg cgatgaggag ataccagaaa 1081 actgcctgga gcagttggag atgggatttc cacggggagc ccagccagcc ccactgctgt 1141 gctccgttct gaaggcctcg ggttctctgc agcagctgtc cctggatagt gccacctttg 1201 cctctcccca ggattttggg cttgttttgc aaacactcaa agagtacaac ctagccctga 1261 aaagactgag cttccatgac atgaatctcg ctgactgtca gagcgaggtg ctctttttgc 1321 tacagaatct gactctgcaa gagattacct tctccttctg ccgtctgttt gagaagcgcc 1381 cagcccaatt tctgcctgag atggttgctg ctatgaaggg caactccaca ctgaagggcc 1441 TCCGGCTGCC AGGGAACCGC CTGGGGAATG CTGGCCTGCT GGCCTTGGCA GATGTTTTCT 1501 CAGAGGATTC ATCCTCCTCT CTCTGTCAGC TGGACATCAG TTCCAACTGC ATCAAGCCAG 1561 ATGGGCTTCT GGAGTTCGCC AAGCGGCTGG AGCGCTGGGG CCGTGGAGCC TTTGGTCACC 1621 TGCGCCTCTT CCAAAACTGG CTGGACCAGG ATGCAGTCAC AGCCAGGGAA GCCATCCGGC 1681 GGCTCCGGGC TACCTGCCAT GTGGTTAGCG ACTCATGGGA CTCATCCCAG GCCTTCGCAG 1741 ATTATGTTAG CACCATGTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1801 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1861 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGTGGGGA TGAATTGAGC 1921 GAAATACACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt