Transcript: Mouse NM_153521.2

Mus musculus leucine rich repeat containing 41 (Lrrc41), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lrrc41 (230654)
Length:
3146
CDS:
141..2564

Additional Resources:

NCBI RefSeq record:
NM_153521.2
NBCI Gene record:
Lrrc41 (230654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_153521.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241809 CGATGTGCTGCTGCACTAATG pLKO_005 1026 CDS 100% 10.800 15.120 N Lrrc41 n/a
2 TRCN0000184713 CCTGTCTATTCGTGTTGACCA pLKO.1 1781 CDS 100% 2.640 2.112 N Lrrc41 n/a
3 TRCN0000241811 ATCTTACCTCTGCTCAATATA pLKO_005 366 CDS 100% 15.000 10.500 N Lrrc41 n/a
4 TRCN0000241810 TAGAGATGAAGGGTCCTTATT pLKO_005 968 CDS 100% 13.200 9.240 N Lrrc41 n/a
5 TRCN0000217026 CTAGAGATGAAGGGTCCTTAT pLKO.1 967 CDS 100% 10.800 7.560 N Lrrc41 n/a
6 TRCN0000217846 CTGATTCTGTCATCCTCTTTC pLKO.1 2647 3UTR 100% 10.800 7.560 N Lrrc41 n/a
7 TRCN0000216525 GTCTTCTGATAAACGTCTTTG pLKO.1 569 CDS 100% 10.800 7.560 N Lrrc41 n/a
8 TRCN0000241807 TGTACCTCCCACTCGTGTAAC pLKO_005 1088 CDS 100% 10.800 7.560 N Lrrc41 n/a
9 TRCN0000165669 GCCAAGTTTATGGAGGCCTTT pLKO.1 516 CDS 100% 4.050 2.835 N LRRC41 n/a
10 TRCN0000241808 TTCTGCCACTTTGTCTATTTC pLKO_005 2665 3UTR 100% 13.200 7.920 N Lrrc41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153521.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11506 pDONR223 100% 61.4% 65.5% None (many diffs) n/a
2 ccsbBroad304_11506 pLX_304 0% 61.4% 65.5% V5 (many diffs) n/a
3 TRCN0000479842 GTGGGGATGAATTGAGCGAAATAC pLX_317 19.1% 61.4% 65.5% V5 (many diffs) n/a
Download CSV