Construct: ORF TRCN0000479862
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017008.1_s317c1
- Derived from:
- ccsbBroadEn_05447
- DNA Barcode:
- GATAGTAGTCCGATGACACATGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAB43 (339122)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479862
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 339122 | RAB43 | RAB43, member RAS oncogene ... | NM_001204883.1 | 100% | 100% | |
| 2 | human | 339122 | RAB43 | RAB43, member RAS oncogene ... | NM_001204884.1 | 100% | 100% | |
| 3 | human | 339122 | RAB43 | RAB43, member RAS oncogene ... | NM_001204885.1 | 100% | 100% | |
| 4 | human | 339122 | RAB43 | RAB43, member RAS oncogene ... | NM_001204886.1 | 100% | 100% | |
| 5 | human | 339122 | RAB43 | RAB43, member RAS oncogene ... | NM_198490.2 | 100% | 100% | |
| 6 | human | 339122 | RAB43 | RAB43, member RAS oncogene ... | NM_001204887.1 | 68.8% | 63.6% | (many diffs) |
| 7 | human | 339122 | RAB43 | RAB43, member RAS oncogene ... | NM_001204888.1 | 50.9% | 33.3% | 189_190insGGCAAGCGGGTCAA;324_325ins298 |
| 8 | mouse | 69834 | Rab43 | RAB43, member RAS oncogene ... | NM_001039394.1 | 88.8% | 91.5% | (many diffs) |
| 9 | mouse | 69834 | Rab43 | RAB43, member RAS oncogene ... | NM_133717.3 | 63.5% | 62.1% | (many diffs) |
| 10 | mouse | 69834 | Rab43 | RAB43, member RAS oncogene ... | NR_104478.1 | 9.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 702
- ORF length:
- 636
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc agggccgggc ccaggcccgg gggacccgga cgagcagtac gatttcctgt 121 tcaagctggt gctggtgggc gacgcaagcg tgggcaagac gtgcgtggtg cagcgcttca 181 agaccggcgc cttctcggag cgccagggaa gcaccatcgg cgtcgacttc accatgaaga 241 cgctggagat ccagggcaag cgggtcaagc tgcagatctg ggacacggcc ggccaggagc 301 ggttccgcac catcacccag agctactacc gcagtgccaa tggggccatc cttgccTACG 361 ACATCACCAA GAGGAGCTCC TTCCTGTCGG TGCCTCACTG GATTGAGGAT GTGAGGAAGT 421 ATGCGGGCTC CAACATTGTG CAGCTGCTGA TCGGGAACAA GTCAGACCTC AGCGAGCTTC 481 GGGAGGTCTC CTTGGCTGAG GCACAGAGCC TGGCTGAGCA CTATGACATC CTGTGTGCCA 541 TTGAGACGTC TGCCAAGGAC TCGAGCAACG TGGAGGAGGC CTTCCTGAGG GTGGCCACGG 601 AGCTCATCAT GCGGCACGGG GGCCCCTTGT TCAGCGAGAA GAGCCCCGAC CACATCCAGC 661 TGAACAGCAA GGACATCGGA GAAGGCTGGG GCTGCGGGTG CTGCCCAACT TTCTTGTACA 721 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 781 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 841 AGGACGAGAT AGTAGTCCGA TGACACATGT TACGCGTTAA GTCgacaatc aacctctgga 901 ttacaaaatt tgtgaaagat t