Transcript: Human NM_001204886.1

Homo sapiens RAB43, member RAS oncogene family (RAB43), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
RAB43 (339122)
Length:
4247
CDS:
65..703

Additional Resources:

NCBI RefSeq record:
NM_001204886.1
NBCI Gene record:
RAB43 (339122)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234622 GCGTCGACTTCACCATGAAGA pLKO_005 219 CDS 100% 4.950 6.930 N RAB43 n/a
2 TRCN0000064970 CCCGGACGAGCAGTACGATTT pLKO.1 94 CDS 100% 3.600 5.040 N RAB43 n/a
3 TRCN0000234621 CAGTACGATTTCCTGTTCAAG pLKO_005 104 CDS 100% 4.950 3.465 N RAB43 n/a
4 TRCN0000064969 GCAGTACGATTTCCTGTTCAA pLKO.1 103 CDS 100% 4.950 3.465 N RAB43 n/a
5 TRCN0000064971 CGAGCAGTACGATTTCCTGTT pLKO.1 100 CDS 100% 4.050 2.835 N RAB43 n/a
6 TRCN0000234625 GCTTCAGTCAGCGCAAGTATT pLKO_005 4049 3UTR 100% 13.200 6.600 Y RAB43 n/a
7 TRCN0000234624 AGTATGCGGGCTCCAACATTG pLKO_005 417 CDS 100% 10.800 5.400 Y RAB43 n/a
8 TRCN0000234623 CCATCCTTGCCTACGACATCA pLKO_005 345 CDS 100% 4.950 2.475 Y RAB43 n/a
9 TRCN0000064972 CCAGCTGAACAGCAAGGACAT pLKO.1 655 CDS 100% 4.050 2.025 Y RAB43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05447 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05447 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479862 GATAGTAGTCCGATGACACATGTT pLX_317 54.2% 100% 100% V5 n/a
Download CSV