Construct: ORF TRCN0000479932
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014436.1_s317c1
- Derived from:
- ccsbBroadEn_07407
- DNA Barcode:
- TTACGTCTCTTCTCCGCGTCCATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SLC22A14 (9389)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479932
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 9389 | SLC22A14 | solute carrier family 22 me... | NM_001320033.1 | 99.8% | 99.6% | 810T>C;850G>A;874A>G |
2 | human | 9389 | SLC22A14 | solute carrier family 22 me... | NM_004803.4 | 99.8% | 99.6% | 810T>C;850G>A;874A>G |
3 | human | 9389 | SLC22A14 | solute carrier family 22 me... | XM_005265585.4 | 99.8% | 99.6% | 810T>C;850G>A;874A>G |
4 | human | 9389 | SLC22A14 | solute carrier family 22 me... | XM_011534245.2 | 99.8% | 99.6% | 810T>C;850G>A;874A>G |
5 | human | 9389 | SLC22A14 | solute carrier family 22 me... | XM_006713416.3 | 87.8% | 87.7% | (many diffs) |
6 | human | 9389 | SLC22A14 | solute carrier family 22 me... | XM_006713417.3 | 86.2% | 85.9% | (many diffs) |
7 | human | 9389 | SLC22A14 | solute carrier family 22 me... | XM_006713418.4 | 80% | 76.4% | (many diffs) |
8 | human | 9389 | SLC22A14 | solute carrier family 22 me... | XM_011534247.2 | 57.1% | 57% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1851
- ORF length:
- 1782
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcaggagag gagaacttca aggaagagct cagatcccag gatgcttcca 121 ggaacttgaa ccagcatgag gtagcaggac atccacattc ctggtctctg gagatgctgt 181 tacgcagatt gagggctgtc cacaccaagc aggatgacaa gtttgccaac ctcctggatg 241 cggtggggga gtttggcaca ttccagcaga ggctagtagc cctcaccttt atccccagca 301 tcatgtcggc cttcttcatg tttgctgacc acttcgtgtt cacagcccag aagccctatt 361 gcaataccag ctggatcctg gcagtgggcc cccacctgtc caaagctgag cagctgaatc 421 tgaccatacc ccaagcaccc aatggcagtt tcctgacatg cttcatgtac cttcctgtgc 481 cttggaatct ggattctatc atccagtttg gcctcaatga cacagacaca tgccaagatg 541 ggtggatcta tcctgacgct aagaagcgat cgctgatcaa tgagtttgac ttggtatgtg 601 gcatggagac gaagaaggac actgcacaga tcatgttcat ggcagggctc ccgataggct 661 ctctcatctt caggctcata actgacaaga tgggccgcta ccctgccatc ctgctgtcac 721 tgctggggct gatcatcttc ggctttggga cagccttcat gaacagcttt cacctgtatt 781 tgttctttcg ctttggcatc tcgcagtcag tggtgggcta cgccatcagc agcatttctt 841 tggccactga gtggttagtg ggtgagcacc gggcccacgc cattatcctg ggacactgct 901 ttttcgctgt tggggccatg ttgctgacag ggatcgccta cggtcttccc cactggcagc 961 tgctgtttct ggtgggtggg atacttgtga tccccttcat ctcctatatc tggattctcc 1021 cggagtcccc gcggtggctg atgatgaaag ggaaggtgaa ggaggccaag caggtgctgt 1081 gctacgccgc aagtgtgaac aagaagacca ttccttcaaa tctgctggac gagctgcagc 1141 tgcccagaaa gaaggtgact cgggcctctg tcctggactt ctgtaagaat aggcagctct 1201 gcaaggtgac cttggtgatg agctgtgtgt ggtttaccgt cagttacacc tattttacgt 1261 tgagcctgag aatgagagag ctgggcgtga gcgtccactt cagacacgtg gtccccagca 1321 tcatggaggt gcctgcccgg ctgtgctgca tctttctcct ccagcagatt gggaggaagt 1381 ggagcctggc tgtgactctc ctccaagcca tcatctggtg cttgcttctc cttttcctcc 1441 ctgaagggga ggatggcctc agactcaagt ggccacgttg tccggccaca gagctgaaat 1501 ccatgacgat cttggtgctc atgcTCAGAG AGTTCAGCCT GGCCGCCACT GTCACTGTGT 1561 TCTTCCTCTA CACCGCTGAG CTCCTCCCCA CTGTGCTCAG GGCGACAGGT CTGGGGCTGG 1621 TGTCTCTGGC CTCGGTGGCT GGAGCCATCT TGTCCCTGAC AATCATCAGC CAGACCCCCT 1681 CCCTCCTGCC CATCTTTCTC TGCTGCGTCT TAGCCATCGT GGCCTTTTCC CTCTCCTCCC 1741 TGCTGCCGGA AACGCGAGAT CAGCCCCTCT CCGAGAGCCT GAACCACTCC TCACAGATAA 1801 GGAATAAGGT CAAGGACATG AAGACTAAGG AAACATCATC TGATGATGTC TTGCCAACTT 1861 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1921 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1981 CTTGTGGAAA GGACGATTAC GTCTCTTCTC CGCGTCCATC ACGCGTTAAG TCgacaatca 2041 acctctggat tacaaaattt gtgaaagatt