Transcript: Human XM_006713418.4

PREDICTED: Homo sapiens solute carrier family 22 member 14 (SLC22A14), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC22A14 (9389)
Length:
2737
CDS:
550..2418

Additional Resources:

NCBI RefSeq record:
XM_006713418.4
NBCI Gene record:
SLC22A14 (9389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006713418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038195 GCTGAAATCCATGACGATCTT pLKO.1 2217 CDS 100% 4.950 3.960 N SLC22A14 n/a
2 TRCN0000038198 GTGGATCTATCCTGACGCTAA pLKO.1 1266 CDS 100% 4.050 3.240 N SLC22A14 n/a
3 TRCN0000415182 GCTAGTAGCCCTCACCTTTAT pLKO_005 996 CDS 100% 13.200 9.240 N SLC22A14 n/a
4 TRCN0000425824 GAGATGCTGTTACGCAGATTG pLKO_005 895 CDS 100% 10.800 7.560 N SLC22A14 n/a
5 TRCN0000415590 GATCGCTGATCAATGAGTTTG pLKO_005 1292 CDS 100% 10.800 7.560 N SLC22A14 n/a
6 TRCN0000038197 AGTGTGAACAAGAAGACCATT pLKO.1 1816 CDS 100% 4.950 3.465 N SLC22A14 n/a
7 TRCN0000038194 CCTGTATTTGTTCTTTCGCTT pLKO.1 1497 CDS 100% 2.640 1.848 N SLC22A14 n/a
8 TRCN0000038196 GCAGGATGACAAGTTTGCCAA pLKO.1 933 CDS 100% 2.640 1.848 N SLC22A14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006713418.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07407 pDONR223 100% 80% 76.4% None (many diffs) n/a
2 ccsbBroad304_07407 pLX_304 0% 80% 76.4% V5 (many diffs) n/a
3 TRCN0000479932 TTACGTCTCTTCTCCGCGTCCATC pLX_317 18.6% 80% 76.4% V5 (many diffs) n/a
4 ccsbBroadEn_07406 pDONR223 100% 79.9% 76.4% None (many diffs) n/a
5 ccsbBroad304_07406 pLX_304 0% 79.9% 76.4% V5 (many diffs) n/a
6 TRCN0000481328 GCTCTCCGATACTAGCCCCTTACA pLX_317 22.8% 79.9% 76.4% V5 (many diffs) n/a
Download CSV