Construct: ORF TRCN0000479959
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003858.3_s317c1
- Derived from:
- ccsbBroadEn_06837
- DNA Barcode:
- CAAAATGCCATTTTTTAAATATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAF1 (5894)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479959
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354690.2 | 99.9% | 99.8% | 1943T>A |
2 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_002880.3 | 99.9% | 99.8% | 1943T>A |
3 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | XM_011533974.3 | 99.9% | 99.8% | 1943T>A |
4 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354689.3 | 96.9% | 96.8% | 835_894del;2003T>A |
5 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354693.2 | 94.8% | 94.5% | 581_582ins99;1844T>A |
6 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | XM_017006966.1 | 94.8% | 94.5% | 581_582ins99;1844T>A |
7 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354691.2 | 87.4% | 83.7% | 0_1ins130;76_77ins113;1700T>A |
8 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354692.2 | 87.4% | 83.7% | 0_1ins130;76_77ins113;1700T>A |
9 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354694.2 | 84.8% | 81.2% | (many diffs) |
10 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NM_001354695.2 | 82.3% | 78.5% | (many diffs) |
11 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NR_148942.2 | 60.9% | (many diffs) | |
12 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NR_148941.2 | 59.9% | (many diffs) | |
13 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | NR_148940.2 | 58.9% | (many diffs) | |
14 | human | 5894 | RAF1 | Raf-1 proto-oncogene, serin... | XR_001740227.1 | 48.3% | (many diffs) | |
15 | mouse | 110157 | Raf1 | v-raf-leukemia viral oncoge... | NM_029780.3 | 90.7% | 97.5% | (many diffs) |
16 | mouse | 110157 | Raf1 | v-raf-leukemia viral oncoge... | XM_006505365.2 | 90.7% | 97.5% | (many diffs) |
17 | mouse | 110157 | Raf1 | v-raf-leukemia viral oncoge... | XM_006505363.3 | 88% | 94.6% | (many diffs) |
18 | mouse | 110157 | Raf1 | v-raf-leukemia viral oncoge... | XM_006505364.2 | 88% | 94.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2010
- ORF length:
- 1944
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gcacatacag ggagcttgga agacgatcag caatggtttt ggattcaaag 121 atgccgtgtt tgatggctcc agctgcatct ctcctacaat agttcagcag tttggctatc 181 agcgccgggc atcagatgat ggcaaactca cagatccttc taagacaagc aacactatcc 241 gtgttttctt gccgaacaag caaagaacag tggtcaatgt gcgaaatgga atgagcttgc 301 atgactgcct tatgaaagca ctcaaggtga ggggcctgca accagagtgc tgtgcagtgt 361 tcagacttct ccacgaacac aaaggtaaaa aagcacgctt agattggaat actgatgctg 421 cgtctttgat tggagaagaa cttcaagtag atttcctgga tcatgttccc ctcacaacac 481 acaactttgc tcggaagacg ttcctgaagc ttgccttctg tgacatctgt cagaaattcc 541 tgctcaatgg atttcgatgt cagacttgtg gctacaaatt tcatgagcac tgtagcacca 601 aagtacctac tatgtgtgtg gactggagta acatcagaca actcttattg tttccaaatt 661 ccactattgg tgatagtgga gtcccagcac taccttcttt gactatgcgt cgtatgcgag 721 agtctgtttc caggatgcct gttagttctc agcacagata ttctacacct cacgccttca 781 cctttaacac ctccagtccc tcatctgaag gttccctctc ccagaggcag aggtcgacat 841 ccacacctaa tgtccacatg gtcagcacca ccctgcctgt ggacagcagg atgattgagg 901 atgcaattcg aagtcacagc gaatcagcct caccttcagc cctgtccagt agccccaaca 961 atctgagccc aacaggctgg tcacagccga aaacccccgt gccagcacaa agagagcggg 1021 caccagtatc tgggacccag gagaaaaaca aaattaggcc tcgtggacag agagattcaa 1081 gctattattg ggaaatagaa gccagtgaag tgatgctgtc cactcggatt gggtcaggct 1141 cttttggaac tgtttataag ggtaaatggc acggagatgt tgcagtaaag atcctaaagg 1201 ttgtcgaccc aaccccagag caattccagg ccttcaggaa tgaggtggct gttctgcgca 1261 aaacacggca tgtgaacatt ctgcttttca tggggtacat gacaaaggac aacctggcaa 1321 ttgtgaccca gtggtgcgag ggcagcagcc tctacaaaca cctgcatgtc caggagacca 1381 agtttcagat gttccagcta attgacattg cccggcagac ggctcaggga atggactatt 1441 tgcatgcaaa gaacatcatc catagagaca tgaaatccaa caatatattt ctccatgaag 1501 gcttaacagt gaaaattgga gattttggtt tggcaacagt aaagtcacgc tggagtggtt 1561 ctcagcaggt tgaacaacct actggctctg tcctctggat ggccccagag gtgatccgaa 1621 tgcaggataa caacccattc agtttccagt cggatgtcta ctcctatggc atcgtattgt 1681 atgaactgat gacgggggag cttccttatt ctcacatcaa caaccgagat cagatcatct 1741 tcatggtggg ccgaggatat gccTCCCCAG ATCTTAGTAA GCTATATAAG AACTGCCCCA 1801 AAGCAATGAA GAGGCTGGTA GCTGACTGTG TGAAGAAAGT AAAGGAAGAG AGGCCTCTTT 1861 TTCCCCAGAT CCTGTCTTCC ATTGAGCTGC TCCAACACTC TCTACCGAAG ATCAACCGGA 1921 GCGCTTCCGA GCCATCCTTG CATCGGGCAG CCCACACTGA GGATATCAAT GCTTGCACGC 1981 TGACCACGTC CCCGAGGCTG CCTGTCTACT ACCCAACTTT CTTGTACAAA GTGGTTGATA 2041 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2101 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACAAAA 2161 TGCCATTTTT TAAATATCAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2221 tgaaagatt