Transcript: Human NM_001354692.2

Homo sapiens Raf-1 proto-oncogene, serine/threonine kinase (RAF1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
RAF1 (5894)
Length:
3071
CDS:
462..2165

Additional Resources:

NCBI RefSeq record:
NM_001354692.2
NBCI Gene record:
RAF1 (5894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001066 CGGAGATGTTGCAGTAAAGAT pLKO.1 1325 CDS 100% 5.625 7.875 N RAF1 n/a
2 TRCN0000196969 GCTGCGTCTTTGATTGGAGAA pLKO.1 570 CDS 100% 4.050 3.240 N RAF1 n/a
3 TRCN0000001068 GAGACATGAAATCCAACAATA pLKO.1 1618 CDS 100% 13.200 9.240 N RAF1 n/a
4 TRCN0000197115 GCTCAGGGAATGGACTATTTG pLKO.1 1575 CDS 100% 13.200 9.240 N RAF1 n/a
5 TRCN0000195502 CTACTCCTATGGCATCGTATT pLKO.1 1811 CDS 100% 10.800 7.560 N RAF1 n/a
6 TRCN0000196264 GCTTTGGTACTATGGAACTTT pLKO.1 2687 3UTR 100% 5.625 3.938 N RAF1 n/a
7 TRCN0000195646 CCAACACTCTCTACCGAAGAT pLKO.1 2045 CDS 100% 4.950 3.465 N RAF1 n/a
8 TRCN0000001065 GCTTCCTTATTCTCACATCAA pLKO.1 1853 CDS 100% 4.950 3.465 N RAF1 n/a
9 TRCN0000012630 GCAGGATGATTGAGGATGCAA pLKO.1 1039 CDS 100% 3.000 2.100 N Raf1 n/a
10 TRCN0000312814 TGTTGCAGTAAAGATCCTAAA pLKO_005 1331 CDS 100% 10.800 6.480 N Raf1 n/a
11 TRCN0000001064 CATGAGTATTTAGAGGAAGTA pLKO.1 2489 3UTR 100% 4.950 2.970 N RAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354692.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14825 pDONR223 0% 87.5% 83.9% None 0_1ins130;76_77ins113 n/a
2 ccsbBroad304_14825 pLX_304 34.6% 87.5% 83.9% V5 0_1ins130;76_77ins113 n/a
3 TRCN0000474946 CACTGCGGGCAAATCGAAGGCAAA pLX_317 7.6% 87.5% 83.9% V5 0_1ins130;76_77ins113 n/a
4 TRCN0000491587 GAAAAGTAACATTCCGAGGGATCT pLX_317 15.3% 87.5% 83.9% V5 (not translated due to prior stop codon) 0_1ins130;76_77ins113 n/a
5 ccsbBroadEn_06837 pDONR223 100% 87.4% 83.7% None 0_1ins130;76_77ins113;1700T>A n/a
6 ccsbBroad304_06837 pLX_304 34.9% 87.4% 83.7% V5 0_1ins130;76_77ins113;1700T>A n/a
7 TRCN0000479959 CAAAATGCCATTTTTTAAATATCA pLX_317 13% 87.4% 83.7% V5 0_1ins130;76_77ins113;1700T>A n/a
Download CSV