Construct: ORF TRCN0000480088
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001239.1_s317c1
- Derived from:
- ccsbBroadEn_04111
- DNA Barcode:
- ACTTCACCCCACCTGCTGCACTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PPCS (79717)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480088
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79717 | PPCS | phosphopantothenoylcysteine... | NM_024664.4 | 100% | 100% | |
2 | human | 79717 | PPCS | phosphopantothenoylcysteine... | NM_001287511.1 | 74.6% | 65.7% | (many diffs) |
3 | human | 79717 | PPCS | phosphopantothenoylcysteine... | NM_001077447.2 | 44.3% | 44.3% | 0_1ins519 |
4 | human | 79717 | PPCS | phosphopantothenoylcysteine... | NM_001287506.1 | 44.3% | 44.3% | 0_1ins519 |
5 | human | 79717 | PPCS | phosphopantothenoylcysteine... | NM_001287508.1 | 44.3% | 44.3% | 0_1ins519 |
6 | human | 79717 | PPCS | phosphopantothenoylcysteine... | NM_001287509.1 | 44.3% | 44.3% | 0_1ins519 |
7 | human | 79717 | PPCS | phosphopantothenoylcysteine... | NM_001287510.1 | 44.3% | 44.3% | 0_1ins519 |
8 | human | 79717 | PPCS | phosphopantothenoylcysteine... | NM_001287507.1 | 33.7% | 33.7% | 0_1ins618 |
9 | mouse | 106564 | Ppcs | phosphopantothenoylcysteine... | NM_026494.3 | 85.6% | 87.4% | (many diffs) |
10 | mouse | 106564 | Ppcs | phosphopantothenoylcysteine... | XM_017319908.1 | 38.3% | 37.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1002
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcggaaatg gatccggtag ccgagttccc ccagcctccc ggtgctgcgc 121 gctgggctga ggttatggct cgcttcgcgg ccaggctggg cgcgcagggc cggcgggtgg 181 tgttggttac gtcaggcggc accaaggtcc cactggaagc gcggccggtg cgcttcctgg 241 acaacttcag cagcgggcgg cgcggtgcaa cctcggccga ggccttccta gccgccggct 301 acggggtcct gttcttgtat cgcgctcgct ctgccttccc ctatgcccac cgcttcccac 361 cccagacttg gctgtccgct ctgcggcctt cgggcccagc cctttcgggc ttgctgagcc 421 tggaggccga ggagaatgca cttccgggtt ttgctgaggc tctgaggagc taccaggagg 481 ctgcggctgc aggcaccttc ctggcagtag agttcaccac tttggcggac tatttgcatc 541 tgttgcaggc tgcggcccag gcactcaatc cgctaggccc ttctgcgatg ttttacctgg 601 ctgcggctgt gtcagatttc tatgttcctg tctctgaaat gcctgaacac aagatccagt 661 catctggggg cccactgcag ataacaatga agatggtgcc aaaactgctt tctcctttgg 721 ttaaagattg ggctcccaaa gcatttataa tttcctttaa gttggagact gaccccgcca 781 ttgtaattaa tcgagctcgg aaggctttgg aaatttatca gcatcaagtg gtggtggcta 841 atatccttga gtCACGACAG TCCTTTGTGT TTATTGTAAC CAAAGACTCG GAAACCAAGT 901 TATTGCTATC AGAGGAAGAA ATAGAAAAAG GCGTAGAGAT AGAAGAGAAG ATAGTGGATA 961 ATCTTCAGTC TCGACACACA GCTTTTATAG GTGACAGAAA CTTGCCAACT TTCTTGTACA 1021 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1081 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1141 AGGACGAACT TCACCCCACC TGCTGCACTG CACGCGTTAA GTCgacaatc aacctctgga 1201 ttacaaaatt tgtgaaagat t