Transcript: Human NM_001287507.1

Homo sapiens phosphopantothenoylcysteine synthetase (PPCS), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PPCS (79717)
Length:
2108
CDS:
487..804

Additional Resources:

NCBI RefSeq record:
NM_001287507.1
NBCI Gene record:
PPCS (79717)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143846 CCTTTGGTTAAAGATTGGGCT pLKO.1 514 CDS 100% 0.660 0.924 N PPCS n/a
2 TRCN0000139871 GCTCGGAAGGCTTTGGAAATT pLKO.1 595 CDS 100% 13.200 9.240 N PPCS n/a
3 TRCN0000122637 GCCTGAATGTCAGCCATCTTT pLKO.1 1072 3UTR 100% 5.625 3.938 N PPCS n/a
4 TRCN0000343667 GCCTGAATGTCAGCCATCTTT pLKO_005 1072 3UTR 100% 5.625 3.938 N PPCS n/a
5 TRCN0000144500 CGGAAACCAAGTTATTGCTAT pLKO.1 689 CDS 100% 4.950 3.465 N PPCS n/a
6 TRCN0000144378 CGTAGAGATAGAAGAGAAGAT pLKO.1 732 CDS 100% 4.950 3.465 N PPCS n/a
7 TRCN0000343609 CGTAGAGATAGAAGAGAAGAT pLKO_005 732 CDS 100% 4.950 3.465 N PPCS n/a
8 TRCN0000145135 GCTGTGTCAGATTTCTATGTT pLKO.1 189 5UTR 100% 5.625 2.813 Y PPCS n/a
9 TRCN0000343608 GCTGTGTCAGATTTCTATGTT pLKO_005 189 5UTR 100% 5.625 2.813 Y PPCS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04111 pDONR223 100% 33.7% 33.7% None 0_1ins618 n/a
2 ccsbBroad304_04111 pLX_304 0% 33.7% 33.7% V5 0_1ins618 n/a
3 TRCN0000480088 ACTTCACCCCACCTGCTGCACTGC pLX_317 16.7% 33.7% 33.7% V5 0_1ins618 n/a
Download CSV