Construct: ORF TRCN0000480117
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016501.1_s317c1
- Derived from:
- ccsbBroadEn_11028
- DNA Barcode:
- ATAGAGCTCCCACAACATGACCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PFKFB1 (5207)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480117
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_001271804.2 | 60.3% | 60.3% | 393_926del |
| 2 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_002625.4 | 57.5% | 57.5% | 222_287del;459_992del |
| 3 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_017029576.1 | 54.2% | 54.2% | 1_24del;246_374del;546_1079del |
| 4 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_024452389.1 | 52.2% | 50.9% | (many diffs) |
| 5 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_001271805.1 | 48.8% | 44.9% | (many diffs) |
| 6 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_017029578.1 | 46.3% | 46.3% | 0_1ins129;93_221del;393_926del |
| 7 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NR_073450.2 | 39.7% | (many diffs) | |
| 8 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | XM_006528755.2 | 52.6% | 55.6% | (many diffs) |
| 9 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | NM_008824.3 | 47.7% | 49.4% | (many diffs) |
| 10 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | XM_011247791.2 | 47.7% | 49.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 882
- ORF length:
- 813
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctccagag atgggagagc tcacccaaac caggttgcag aagatctgga 121 ttccacacag cagcggcagc agcaggctgc aacggagaag gggctcatcc ataccccagt 181 ttaccaattc ccccacaatg gtgatcatgg tgggtttacc agctcgaggc aagacctata 241 tctccacaaa gctcacacga tatctcaact ggataggaac accaactaaa gacaacatgg 301 aagccctgca aatcaggaag cagtgcgccc tggcagccct gaaggatgtt cacaactatc 361 tcagccatga ggaaggtcat gttgcggttt ttgatgccac caacactacc agagaacgac 421 ggtcactgat cctgcagttt gcaaaagaac atggttacaa gggtgtctgt gaggagatga 481 ccTATGAAGA AATCCAGGAA CATTACCCTG AAGAATTTGC ACTGCGAGAC CAAGATAAAT 541 ATCGCTACCG CTATCCCAAG GGAGAGTCCT ATGAGGATCT GGTTCAGCGT CTGGAGCCAG 601 TGATAATGGA GCTAGAACGA CAGGAGAATG TACTGGTGAT CTGCCACCAG GCTGTCATGC 661 GGTGCCTCCT GGCCTATTTC CTGGATAAAA GTTCAGATGA GCTTCCATAT CTCAAGTGCC 721 CTCTGCACAC AGTGCTCAAA CTCACTCCTG TGGCTTATGG CTGCAAAGTG GAATCCATCT 781 ACCTGAATGT GGAGGCCGTG AACACACACC GGGAGAAGCC TGAGAATGTG GACATCACCC 841 GGGAACCTGA GGAAGCCCTG GATACTGTCC CAGCCCACTA CTTGCCAACT TTCTTGTACA 901 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 961 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1021 AGGACGAATA GAGCTCCCAC AACATGACCT CACGCGTTAA GTCgacaatc aacctctgga 1081 ttacaaaatt tgtgaaagat t