Transcript: Human XM_024452389.1

PREDICTED: Homo sapiens 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (PFKFB1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFKFB1 (5207)
Length:
3211
CDS:
1620..2966

Additional Resources:

NCBI RefSeq record:
XM_024452389.1
NBCI Gene record:
PFKFB1 (5207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037592 GCACTGCGAGACCAAGATAAA pLKO.1 2601 CDS 100% 13.200 10.560 N PFKFB1 n/a
2 TRCN0000037589 GCAGTGAGCTACAAGAACTAT pLKO.1 1803 CDS 100% 5.625 4.500 N PFKFB1 n/a
3 TRCN0000333254 GCAGTGAGCTACAAGAACTAT pLKO_005 1803 CDS 100% 5.625 4.500 N PFKFB1 n/a
4 TRCN0000199261 CTCATCGCCTTCCACCTTTAG pLKO.1 2998 3UTR 100% 10.800 7.560 N PFKFB1 n/a
5 TRCN0000194803 CTTTAGGAAATGCTATCTTTG pLKO.1 3013 3UTR 100% 10.800 7.560 N PFKFB1 n/a
6 TRCN0000025627 CCACCTGTCCTACATCAAGAT pLKO.1 2189 CDS 100% 4.950 3.465 N Pfkfb1 n/a
7 TRCN0000199064 CCAGGAACATTACCCTGAAGA pLKO.1 2576 CDS 100% 4.950 3.465 N PFKFB1 n/a
8 TRCN0000344729 CCAGGAACATTACCCTGAAGA pLKO_005 2576 CDS 100% 4.950 3.465 N PFKFB1 n/a
9 TRCN0000037593 CTAAAGAGAATTGAGTGCTAT pLKO.1 2130 CDS 100% 4.950 3.465 N PFKFB1 n/a
10 TRCN0000037591 GCAAGACCTATATCTCCACAA pLKO.1 1711 CDS 100% 4.050 2.835 N PFKFB1 n/a
11 TRCN0000333174 GCAAGACCTATATCTCCACAA pLKO_005 1711 CDS 100% 4.050 2.835 N PFKFB1 n/a
12 TRCN0000199301 CGGCAAGCAGTATGCCTATGC pLKO.1 2387 CDS 100% 1.350 0.945 N PFKFB1 n/a
13 TRCN0000344790 CGGCAAGCAGTATGCCTATGC pLKO_005 2387 CDS 100% 1.350 0.945 N PFKFB1 n/a
14 TRCN0000199728 GCCTGTGTCCTCATCGCCTTC pLKO.1 2989 3UTR 100% 0.000 0.000 N PFKFB1 n/a
15 TRCN0000037590 CTGGCCTATTTCCTGGATAAA pLKO.1 2751 CDS 100% 13.200 7.920 N PFKFB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06714 pDONR223 100% 94.6% 93.2% None (many diffs) n/a
2 TRCN0000465209 CCAAGAGATCCAATCTGACACCAC pLX_317 15.7% 94.6% 93.2% V5 (many diffs) n/a
3 TRCN0000468677 AGGTCTCTTACCTTAGGAGACTTT pLX_317 27% 80.4% 65.1% V5 (many diffs) n/a
4 ccsbBroadEn_14742 pDONR223 50% 66.7% 44.5% None (many diffs) n/a
5 ccsbBroad304_14742 pLX_304 0% 66.7% 44.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_11028 pDONR223 100% 52.2% 50.9% None (many diffs) n/a
7 ccsbBroad304_11028 pLX_304 0% 52.2% 50.9% V5 (many diffs) n/a
8 TRCN0000480117 ATAGAGCTCCCACAACATGACCTC pLX_317 49% 52.2% 50.9% V5 (many diffs) n/a
Download CSV