Construct: ORF TRCN0000480183
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009707.1_s317c1
- Derived from:
- ccsbBroadEn_12550
- DNA Barcode:
- GGTTATGCTCGTCAGCGGACACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FA2H (79152)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480183
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79152 | FA2H | fatty acid 2-hydroxylase | XM_011523319.2 | 95.7% | 95.8% | 1_36del;639C>T |
| 2 | human | 79152 | FA2H | fatty acid 2-hydroxylase | NM_024306.5 | 75.1% | 75.2% | 1_276del;879C>T |
| 3 | human | 79152 | FA2H | fatty acid 2-hydroxylase | XM_011523317.3 | 56.2% | 47.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 906
- ORF length:
- 840
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaacgagcct gtagcccttg aggaaactca gaagacagat cctgctatgg 121 aaccacggtt caaagtggtg gattgggaca aggacctggt ggactggcga aagcctctcc 181 tgtggcaggt gggccacttg ggagagaagt acgatgagtg ggttcaccag ccggtgacca 241 ggcccatccg cctcttccac tcagacctca ttgagggcct ctctaagact gtctggtaca 301 gtgtccccat catctgggtg cccctggtgc tgtatctcag ctggtcctac taccgaacct 361 ttgcccaggg caacgtccga ctcttcacgt catttacaac agagtacacg gtggcagtgc 421 ccaagtccat gttccccggg ctcttcatgc tggggacatt cctctggagc ctcatcgagt 481 accTCATCCA CCGCTTCCTG TTCCACATGA AGCCCCCCAG CGACAGCTAT TACCTCATCA 541 TGCTGCACTT CGTCATGCAC GGCCAGCACC ACAAGGCACC CTTCGACGGC TCCCGCCTGG 601 TCTTCCCCCC TGTGCCAGCC TCCCTGGTGA TCGGCGTCTT CTACTTGTGC ATGCAGCTCA 661 TCCTGCCTGA GGCAGTAGGG GGCACTGTGT TTGCGGGGGG CCTCCTGGGC TACGTCCTCT 721 ATGACATGAC CCATTACTAC CTGCACTTTG GCTCGCCGCA CAAGGGCTCC TACCTGTACA 781 GCCTGAAGGC CCACCACGTC AAGCACCACT TTGCACATCA GAAGTCAGGA TTTGGTATCA 841 GCACTAAATT GTGGGATTAC TGTTTCCACA CCCTCACTCC AGAGAAACCC CACCTGAAGA 901 CGCAGTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 961 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1021 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGGTTATGCT CGTCAGCGGA CACCGACGCG 1081 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt