Transcript: Human XM_011523317.3

PREDICTED: Homo sapiens fatty acid 2-hydroxylase (FA2H), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FA2H (79152)
Length:
2988
CDS:
77..1186

Additional Resources:

NCBI RefSeq record:
XM_011523317.3
NBCI Gene record:
FA2H (79152)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420249 GTATCTCAGCTGGTCCTACTA pLKO_005 619 CDS 100% 4.950 3.960 N FA2H n/a
2 TRCN0000150023 CACGTCATTTACAACAGAGTA pLKO.1 673 CDS 100% 4.950 3.465 N FA2H n/a
3 TRCN0000148905 CGACAGCTATTACCTCATCAT pLKO.1 808 CDS 100% 4.950 3.465 N FA2H n/a
4 TRCN0000149228 GAGGAAACTCAGAAGACAGAT pLKO.1 377 CDS 100% 4.950 3.465 N FA2H n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12550 pDONR223 100% 56.2% 47.9% None (many diffs) n/a
2 ccsbBroad304_12550 pLX_304 0% 56.2% 47.9% V5 (many diffs) n/a
3 TRCN0000480183 GGTTATGCTCGTCAGCGGACACCG pLX_317 50.3% 56.2% 47.9% V5 (many diffs) n/a
4 TRCN0000488889 CCGTATATAGCCTTACTGTTTGGA pLX_317 38.8% 56.2% 47.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_12551 pDONR223 100% 56% 47.9% None (many diffs) n/a
6 ccsbBroad304_12551 pLX_304 0% 56% 47.9% V5 (many diffs) n/a
Download CSV