Construct: ORF TRCN0000480257
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000323.1_s317c1
- Derived from:
- ccsbBroadEn_06890
- DNA Barcode:
- CTAGGTGCTGTTGTACAAGACGAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RPS2 (6187)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480257
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6187 | RPS2 | ribosomal protein S2 | NM_002952.4 | 99.8% | 100% | 261T>C |
| 2 | human | 256355 | RPS2P32 | ribosomal protein S2 pseudo... | NR_026676.1 | 76.7% | (many diffs) | |
| 3 | mouse | 16898 | Rps2 | ribosomal protein S2 | NM_008503.5 | 87.4% | 98.6% | (many diffs) |
| 4 | mouse | 677044 | Gm10653 | predicted gene 10653; ribso... | NR_003965.2 | 56.7% | (many diffs) | |
| 5 | mouse | 108167548 | Gm45855 | predicted gene 45855; 40S r... | XR_001778644.1 | 49.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 945
- ORF length:
- 879
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggatgacgcc ggtgcagcgg gggggcccgg gggccctggt ggccctggga 121 tggggaaccg cggtggcttc cgcggaggtt tcggcagtgg catccggggc cggggtcgcg 181 gccgtggacg gggccggggc cgaggccgcg gagctcgcgg aggcaaggcc gaggataagg 241 agtggatgcc cgtcaccaag ttgggccgct tggtcaagga catgaagatc aagtccctgg 301 aggagatcta tctcttctcc ctgcccatta aggaatcaga gatcattgat ttcttcctgg 361 gggcctctct caaggatgag gttttgaaga ttatgccagt gcagaagcag acccgtgccg 421 gccagcgcac caggttcaag gcatttgttg ctatcgggga ctacaatggc cacgtcggtc 481 tgggtgttaa gtgctccaag gaggtggcca ccgccatccg tggggccatc atcctggcca 541 agctctccat cgtccccgtg cgcagaggct actgggggaa caagatcggc aagcccCACA 601 CTGTCCCTTG CAAGGTGACA GGCCGCTGCG GCTCTGTGCT GGTACGCCTC ATCCCTGCAC 661 CCAGGGGCAC TGGCATCGTC TCCGCACCTG TGCCTAAGAA GCTGCTCATG ATGGCTGGTA 721 TCGATGACTG CTACACCTCA GCCCGGGGCT GCACTGCCAC CCTGGGCAAC TTCGCCAAGG 781 CCACCTTTGA TGCCATTTCT AAGACCTACA GCTACCTGAC CCCCGACCTC TGGAAGGAGA 841 CTGTATTCAC CAAGTCTCCC TATCAGGAGT TCACTGACCA CCTCGTCAAG ACCCACACCA 901 GAGTCTCCGT GCAGCGGACT CAGGCTCCAG CTGTGGCTAC AACATACCCA ACTTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA CTAGGTGCTG TTGTACAAGA CGAGACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt