Transcript: Mouse XR_001778644.1

PREDICTED: Mus musculus 40S ribosomal protein S2 pseudogene (LOC108167548), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm45855 (108167548)
Length:
1566
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778644.1
NBCI Gene record:
Gm45855 (108167548)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054674 CCTCTGGAAAGAGACTGTCTT pLKO.1 1446 3UTR 100% 4.950 2.475 Y Rps2 n/a
2 TRCN0000349538 CCTCTGGAAAGAGACTGTCTT pLKO_005 1446 3UTR 100% 4.950 2.475 Y Rps2 n/a
3 TRCN0000054677 CTAAAGGATGAGGTTCTGAAA pLKO.1 988 3UTR 100% 4.950 2.475 Y Rps2 n/a
4 TRCN0000318143 CTAAAGGATGAGGTTCTGAAA pLKO_005 988 3UTR 100% 4.950 2.475 Y Rps2 n/a
5 TRCN0000054675 GCCCATTAAGGAGTCTGAGAT pLKO.1 942 3UTR 100% 4.950 2.475 Y Rps2 n/a
6 TRCN0000318070 GCCCATTAAGGAGTCTGAGAT pLKO_005 942 3UTR 100% 4.950 2.475 Y Rps2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15576 pDONR223 0% 49.3% None (many diffs) n/a
2 ccsbBroad304_15576 pLX_304 0% 49.3% V5 (many diffs) n/a
3 TRCN0000475710 ATTACGGACAGTTCATAGTGATTT pLX_317 34.1% 49.3% V5 (many diffs) n/a
4 ccsbBroadEn_06890 pDONR223 100% 49.2% None (many diffs) n/a
5 ccsbBroad304_06890 pLX_304 0% 49.2% V5 (many diffs) n/a
6 TRCN0000480257 CTAGGTGCTGTTGTACAAGACGAG pLX_317 39.9% 49.2% V5 (many diffs) n/a
7 ccsbBroadEn_06891 pDONR223 100% 49.2% None (many diffs) n/a
8 ccsbBroad304_06891 pLX_304 0% 49.2% V5 (many diffs) n/a
9 TRCN0000480337 GACCTACGAGGTCAGACATACTCG pLX_317 44.4% 49.2% V5 (many diffs) n/a
10 ccsbBroadEn_15577 pDONR223 0% 49% None (many diffs) n/a
11 ccsbBroad304_15577 pLX_304 0% 49% V5 (many diffs) n/a
12 TRCN0000479794 CGTATACTCAACGCACATAACGAG pLX_317 40.7% 49% V5 (many diffs) n/a
Download CSV