Construct: ORF TRCN0000480276
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004272.2_s317c1
- Derived from:
- ccsbBroadEn_12323
- DNA Barcode:
- GAAAAGGCACGCGACGAGTTTGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- COQ8A (56997)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480276
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56997 | COQ8A | coenzyme Q8A | NM_020247.5 | 63.3% | 63.3% | 1231_1941del |
| 2 | human | 56997 | COQ8A | coenzyme Q8A | XM_005273201.1 | 63.3% | 63.3% | 1231_1941del |
| 3 | human | 56997 | COQ8A | coenzyme Q8A | XM_011544238.1 | 63.3% | 63.3% | 1231_1941del |
| 4 | human | 56997 | COQ8A | coenzyme Q8A | XM_011544239.2 | 63.3% | 63.3% | 1231_1941del |
| 5 | human | 56997 | COQ8A | coenzyme Q8A | XM_011544241.2 | 63.3% | 63.3% | 1231_1941del |
| 6 | human | 56997 | COQ8A | coenzyme Q8A | XM_017001852.1 | 63.3% | 63.3% | 1231_1941del |
| 7 | human | 56997 | COQ8A | coenzyme Q8A | XM_024448517.1 | 63.3% | 63.3% | 1231_1941del |
| 8 | human | 56997 | COQ8A | coenzyme Q8A | XM_024448518.1 | 63.3% | 63.3% | 1231_1941del |
| 9 | mouse | 67426 | Coq8a | coenzyme Q8A | XM_011238855.2 | 35.9% | 38.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1299
- ORF length:
- 1230
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctgccata ttgggagaca ccatcatggt ggctaaaggc cttgtcaagc 121 tgacccaggc ggccgtggaa acccacctgc agcacttggg catcggaggg gagctgatca 181 tggcggccag ggccctgcag tccacggctg tggagcagat tggcatgttc ttggggaagg 241 tgcagggtca ggataaacat gaagaatatt ttgctgagaa cttcggcggc ccagaagggg 301 agttccactt ctcagtcccg catgcagccg gagcctccac agacttctct tcagcctccg 361 ctcccgacca gtcagcgccc ccatccctgg gtcatgccca cagcgagggc ccagctcctg 421 cctacgtggc cagtggaccc tttagagaag ccgggttccc cggccaggcc tcctcccctc 481 tgggcagggc caacgggagg ctctttgcaa accccagaga ctcattctct gccatgggct 541 ttcagcgaag gttcttccac caggaccaat cccctgttgg gggcctcaca gccgaggaca 601 ttgagaaggc ccggcaggct aaggctcgcc ccgagaacaa gcagcacaaa cagacgctca 661 gcgagcatgc ccgggagcgg aaggtgcctg tgacgaggat tggccggctg gccaacttcg 721 gaggtctggc cgtgggcctg ggcttcgggg cactggcaga ggtcgccaag aagagcctgc 781 gctccgagga cccctcaggg aagaaggccg tgctgggttc cagtcctttc ctgtccgagg 841 ccaatgcaga gcggatcgtg cgcacgcTCT GCAAGGTGCG TGGTGCGGCA CTCAAGCTGG 901 GCCAGATGCT GAGCATCCAG GATGATGCCT TTATCAACCC CCACCTGGCT AAGATCTTCG 961 AGCGGGTGCG GCAGAGCGCG GACTTCATGC CACTGAAGCA GATGATGAAA ACTCTCAACA 1021 ACGACCTGGG CCCCAACTGG CGGGACAAGT TGGAATACTT CGAGGAGCGG CCCTTCGCCG 1081 CCGCATCCAT TGGGCAGGTG CACTTGGCCC GAATGAAGGG CGGCCGCGAG GTGGCCATGA 1141 AGATCCAGTA CCCTGGCGTG GCCCAGAGCA TCAACAGTGA TGTCAACAAC CTCATGGCCG 1201 TGTTGAACAT GAGCAACATG CTTCCAGAAG GCCTGTTCCC CGAGCACCTG ATCGACGTGC 1261 TGAGGCGGGA GCTGGCCCTG GAGTGTGACT ACCAGCGATT GCCAACTTTC TTGTACAAAG 1321 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1381 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1441 ACGAGAAAAG GCACGCGACG AGTTTGTTAC GCGTTAAGTC gacaatcaac ctctggatta 1501 caaaatttgt gaaagatt