Transcript: Human XM_024448517.1

PREDICTED: Homo sapiens coenzyme Q8A (COQ8A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COQ8A (56997)
Length:
2965
CDS:
215..2158

Additional Resources:

NCBI RefSeq record:
XM_024448517.1
NBCI Gene record:
COQ8A (56997)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021506 CGACCTCTACATTCAGATCAT pLKO.1 1771 CDS 100% 4.950 6.930 N COQ8A n/a
2 TRCN0000199442 GCGGACTTCATGCCACTGAAG pLKO.1 1124 CDS 100% 0.135 0.189 N COQ8A n/a
3 TRCN0000021505 GCGGGACAAGTTGGAATACTT pLKO.1 1186 CDS 100% 5.625 4.500 N COQ8A n/a
4 TRCN0000350549 CATCCAGGATGATGCCTTTAT pLKO_005 1060 CDS 100% 13.200 9.240 N COQ8A n/a
5 TRCN0000021504 CCACGGTTTCTGTTGCTAAAT pLKO.1 2305 3UTR 100% 13.200 9.240 N COQ8A n/a
6 TRCN0000315428 CCACGGTTTCTGTTGCTAAAT pLKO_005 2305 3UTR 100% 13.200 9.240 N COQ8A n/a
7 TRCN0000315429 CCGAGAACAAGCAGCACAAAC pLKO_005 777 CDS 100% 10.800 7.560 N COQ8A n/a
8 TRCN0000350551 CCTTCACCGACCTCTACATTC pLKO_005 1764 CDS 100% 10.800 7.560 N COQ8A n/a
9 TRCN0000350608 CTGGCGGGACAAGTTGGAATA pLKO_005 1183 CDS 100% 10.800 7.560 N COQ8A n/a
10 TRCN0000380420 GAAGGTGCAGGGTCAGGATAA pLKO_005 382 CDS 100% 10.800 7.560 N COQ8A n/a
11 TRCN0000381803 ACAACCTCATGGCCGTGTTGA pLKO_005 1332 CDS 100% 4.950 3.465 N COQ8A n/a
12 TRCN0000021508 CCCGAGAACAAGCAGCACAAA pLKO.1 776 CDS 100% 4.950 3.465 N COQ8A n/a
13 TRCN0000195738 CGAAATCCATAGAGATGAAGT pLKO.1 1830 CDS 100% 4.950 3.465 N COQ8A n/a
14 TRCN0000379784 GAACGAGATCTGCTACAACAT pLKO_005 1606 CDS 100% 4.950 3.465 N COQ8A n/a
15 TRCN0000021507 GCATCCAGGATGATGCCTTTA pLKO.1 1059 CDS 100% 1.080 0.756 N COQ8A n/a
16 TRCN0000199375 CCTCCGTGTGTCCTCTGAAAT pLKO.1 2383 3UTR 100% 13.200 7.920 N COQ8A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448517.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08681 pDONR223 100% 99.9% 100% None 1185C>T n/a
2 ccsbBroad304_08681 pLX_304 0% 99.9% 100% V5 1185C>T n/a
3 TRCN0000480325 CATAAGCAAGGTCTTTGGAAAGTC pLX_317 22.3% 99.9% 100% V5 1185C>T n/a
4 ccsbBroadEn_15116 pDONR223 0% 99.9% 100% None 1185C>T n/a
5 ccsbBroad304_15116 pLX_304 0% 99.9% 100% V5 1185C>T n/a
6 TRCN0000480598 CACCATGCATAGCCTTAACACGAA pLX_317 19.3% 99.9% 100% V5 1185C>T n/a
7 TRCN0000489114 GATTAAATTGAGTCTTAGATCCTT pLX_317 12.2% 99.9% 100% V5 (not translated due to prior stop codon) 1185C>T n/a
8 ccsbBroadEn_12323 pDONR223 100% 63.3% 63.3% None 1231_1941del n/a
9 ccsbBroad304_12323 pLX_304 0% 63.3% 63.3% V5 1231_1941del n/a
10 TRCN0000480276 GAAAAGGCACGCGACGAGTTTGTT pLX_317 35.2% 63.3% 63.3% V5 1231_1941del n/a
Download CSV