Construct: ORF TRCN0000480439
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011767.1_s317c1
- Derived from:
- ccsbBroadEn_10739
- DNA Barcode:
- ATGCGCGGTAAAAACAATTGACTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- COL2A1 (1280)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480439
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1280 | COL2A1 | collagen type II alpha 1 chain | XM_017018831.2 | 20.1% | 20.1% | 1_3111del;3901_3915del |
| 2 | human | 1280 | COL2A1 | collagen type II alpha 1 chain | NM_033150.3 | 18.5% | 18.5% | 1_3450del;4240_4254del |
| 3 | human | 1280 | COL2A1 | collagen type II alpha 1 chain | XM_017018830.1 | 17.9% | 17.9% | 1_3591del;4381_4395del |
| 4 | human | 1280 | COL2A1 | collagen type II alpha 1 chain | NM_001844.5 | 17.6% | 17.6% | 1_3657del;4447_4461del |
| 5 | human | 1280 | COL2A1 | collagen type II alpha 1 chain | XM_017018829.1 | 17.1% | 17.1% | 1_3798del;4588_4602del |
| 6 | human | 1280 | COL2A1 | collagen type II alpha 1 chain | XM_017018828.1 | 17.1% | 17.1% | 1_3801del;4591_4605del |
| 7 | mouse | 12824 | Col2a1 | collagen, type II, alpha 1 | XM_006520386.3 | 18.1% | 19% | (many diffs) |
| 8 | mouse | 12824 | Col2a1 | collagen, type II, alpha 1 | NM_001113515.2 | 16.7% | 17.4% | (many diffs) |
| 9 | mouse | 12824 | Col2a1 | collagen, type II, alpha 1 | NM_031163.3 | 15.9% | 16.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 855
- ORF length:
- 789
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cgcctttgct ggcttaggcc cgagagagaa gggccccgac cccctgcagt 121 acatgcgggc cgaccaggca gccggtggcc tgagacagca tgacgccgag gtggatgcca 181 cactcaagtc cctcaacaac cagattgaga gcatccgcag ccccgagggc tcccgcaaga 241 accctgctcg cacctgcaga gacctgaaac tctgccaccc tgagtggaag agtggagact 301 actggattga ccccaaccaa ggctgcacct tggacgccat gaaggttttc tgcaacatgg 361 agactggcga gacttgcgtc taccccaatc cagcaaacgt tcccaagaag aactggtgga 421 gcagcaagag caaggagaag aaacacatct ggtttggaga aaccatcaat ggtggcttcc 481 atttcagcta tggagatgac aatctggctc ccaacactgc caacgtccag atgaccttcc 541 TACGCCTGCT GTCCACGGAA GGCTCCCAGA ACATCACCTA CCACTGCAAG AACAGCATTG 601 CCTATCTGGA CGAAGCAGCT GGCAACCTCA AGAAGGCCCT GCTCATCCAG GGCTCCAATG 661 ACGTGGAGAT CCGGGCAGAG GGCAATAGCA GGTTCACGTA CACTGCCCTG AAGGATGGCT 721 GCACGAAACA TACCGGTAAG TGGGGCAAGA CTGTTATCGA GTACCGGTCA CAGAAGACCT 781 CACGCCTCCC CATCATTGAC ATTGCACCCA TGGACATAGG AGGGCCCGAG CAGGAATTCG 841 GTGTGGACAT AGGGCCGGTC TGCTTCTTGT ACCCAACTTT CTTGTACAAA GTGGTTGATA 901 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 961 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAATGCG 1021 CGGTAAAAAC AATTGACTAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1081 tgaaagatt