Transcript: Human XM_017018829.1

PREDICTED: Homo sapiens collagen type II alpha 1 chain (COL2A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL2A1 (1280)
Length:
5167
CDS:
123..4727

Additional Resources:

NCBI RefSeq record:
XM_017018829.1
NBCI Gene record:
COL2A1 (1280)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000331104 CTGGAGTGACTGGTCCTAAAG pLKO_005 2896 CDS 100% 10.800 15.120 N COL2A1 n/a
2 TRCN0000083627 CACACTCAAGTCCCTCAACAA pLKO.1 4034 CDS 100% 4.950 6.930 N COL2A1 n/a
3 TRCN0000296937 GGCCGGTCTGCTTCTTGTAAA pLKO_005 4708 CDS 100% 13.200 10.560 N COL2A1 n/a
4 TRCN0000083626 CAGAGGTATAATGATAAGGAT pLKO.1 378 CDS 100% 3.000 2.400 N COL2A1 n/a
5 TRCN0000083623 CCTGACCTGATGTCCATTCAT pLKO.1 4825 3UTR 100% 5.625 3.938 N COL2A1 n/a
6 TRCN0000291580 CCTGACCTGATGTCCATTCAT pLKO_005 4825 3UTR 100% 5.625 3.938 N COL2A1 n/a
7 TRCN0000083625 GCTGGCTTCAAAGGTGAACAA pLKO.1 1644 CDS 100% 4.950 3.465 N COL2A1 n/a
8 TRCN0000291581 GCTGGCTTCAAAGGTGAACAA pLKO_005 1644 CDS 100% 4.950 3.465 N COL2A1 n/a
9 TRCN0000083624 CCTCAAGGATTTCAAGGCAAT pLKO.1 921 CDS 100% 4.050 2.835 N COL2A1 n/a
10 TRCN0000296938 CTGTCCTCTGCGACGACATAA pLKO_005 445 CDS 100% 13.200 7.920 N COL2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10739 pDONR223 100% 17.1% 17.1% None 1_3798del;4588_4602del n/a
2 ccsbBroad304_10739 pLX_304 0% 17.1% 17.1% V5 1_3798del;4588_4602del n/a
3 TRCN0000480439 ATGCGCGGTAAAAACAATTGACTA pLX_317 41.2% 17.1% 17.1% V5 1_3798del;4588_4602del n/a
Download CSV