Construct: ORF TRCN0000480480
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003523.1_s317c1
- Derived from:
- ccsbBroadEn_03922
- DNA Barcode:
- CGACCTGAGAACGGTCAACAAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SMOC1 (64093)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480480
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 64093 | SMOC1 | SPARC related modular calci... | NM_022137.6 | 100% | 100% | |
2 | human | 64093 | SMOC1 | SPARC related modular calci... | NM_001034852.3 | 99.7% | 99.7% | 1290_1292delAGT |
3 | human | 64093 | SMOC1 | SPARC related modular calci... | XM_005267996.1 | 97.5% | 97.5% | 525_557del |
4 | human | 64093 | SMOC1 | SPARC related modular calci... | XM_005267995.1 | 97.3% | 97.3% | 525_557del;1323_1325delAGT |
5 | mouse | 64075 | Smoc1 | SPARC related modular calci... | NM_022316.2 | 86.2% | 91.6% | (many diffs) |
6 | mouse | 64075 | Smoc1 | SPARC related modular calci... | NM_001146217.1 | 84.2% | 89.4% | (many diffs) |
7 | mouse | 64075 | Smoc1 | SPARC related modular calci... | XM_006516135.3 | 79.3% | 80.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1368
- ORF length:
- 1302
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gcccgcgcgc tgcgcccgcc tgctcacgcc ccacttgctg ctggtgttgg 121 tgcagctgtc ccctgctcgc ggccaccgca ccacaggccc caggtttcta ataagtgacc 181 gtgacccaca gtgcaacctc cactgctcca ggactcaacc caaacccatc tgtgcctctg 241 atggcaggtc ctacgagtcc atgtgtgagt accagcgagc caagtgccga gacccgaccc 301 tgggcgtggt gcatcgaggt agatgcaaag atgctggcca gagcaagtgt cgcctggagc 361 gggctcaagc cctggagcaa gccaagaagc ctcaggaagc tgtgtttgtc ccagagtgtg 421 gcgaggatgg ctcctttacc caggtgcagt gccatactta cactgggtac tgctggtgtg 481 tcaccccgga tgggaagccc atcagtggct cttctgtgca gaataaaact cctgtatgtt 541 caggttcagt caccgacaag cccttgagcc agggtaactc aggaaggaaa gatgacgggt 601 ctaagccgac acccacgatg gagacccagc cggtgttcga tggagatgaa atcacagccc 661 caactctatg gattaaacac ttggtgatca aggactccaa actgaacaac accaacataa 721 gaaattcaga gaaagtctat tcgtgtgacc aggagaggca gagtgccctg gaagaggccc 781 agcagaatcc ccgtgagggt attgtcatcc ctgaatgtgc ccctggggga ctctataagc 841 cagtgcaatg ccaccagtcc actggctact gctggtgtgt gctggtggac acagggcgcc 901 cgctgcctgg gacctccaca cgctacgtga tgcccagttg tgagagcgac gccagggcca 961 agactacaga ggcggatgac cccttcaagg acagggagct accaggctgt ccagaaggga 1021 agaaaatgga gtttatcacc agccTACTGG ATGCTCTCAC CACTGACATG GTTCAGGCCA 1081 TTAACTCAGC AGCGCCCACT GGAGGTGGGA GGTTCTCAGA GCCAGACCCC AGCCACACCC 1141 TGGAGGAGCG GGTAGTGCAC TGGTATTTCA GCCAGCTGGA CAGCAATAGC AGCAACGACA 1201 TTAACAAGCG GGAGATGAAG CCCTTCAAGC GCTACGTGAA GAAGAAAGCC AAGCCCAAGA 1261 AATGTGCCCG GCGTTTCACC GACTACTGTG ACCTGAACAA AGACAAGGTC ATTTCACTGC 1321 CTGAGCTGAA GGGCTGCCTG GGTGTTAGCA AAGAAGGACG CCTCGTCTAC CCAACTTTCT 1381 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1441 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1501 GTGGAAAGGA CGACGACCTG AGAACGGTCA ACAAGATACG CGTTAAGTCg acaatcaacc 1561 tctggattac aaaatttgtg aaagatt