Transcript: Mouse NM_022316.2

Mus musculus SPARC related modular calcium binding 1 (Smoc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Smoc1 (64075)
Length:
3463
CDS:
256..1614

Additional Resources:

NCBI RefSeq record:
NM_022316.2
NBCI Gene record:
Smoc1 (64075)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_022316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080175 CCACACGCTATGTGATGCCAA pLKO.1 1103 CDS 100% 2.640 2.112 N Smoc1 n/a
2 TRCN0000080177 CGATGACATTAACAAGCGGGA pLKO.1 1380 CDS 100% 0.540 0.432 N Smoc1 n/a
3 TRCN0000313818 GACATGGTTCAGGCCATTAAC pLKO_005 1252 CDS 100% 13.200 9.240 N Smoc1 n/a
4 TRCN0000373667 GACATGGTTCAGGCCATTAAC pLKO_005 1252 CDS 100% 13.200 9.240 N SMOC1 n/a
5 TRCN0000313817 GCAACAGCAGCGATGACATTA pLKO_005 1370 CDS 100% 13.200 9.240 N Smoc1 n/a
6 TRCN0000080176 CCTGTGTTCGATGGAGATGAA pLKO.1 817 CDS 100% 4.950 3.465 N Smoc1 n/a
7 TRCN0000317338 CCTGTGTTCGATGGAGATGAA pLKO_005 817 CDS 100% 4.950 3.465 N Smoc1 n/a
8 TRCN0000053412 CTACGAGTCCATGTGTGAGTA pLKO.1 438 CDS 100% 4.950 3.465 N SMOC1 n/a
9 TRCN0000080174 GCCAGGGTAATTCAGGAAGAA pLKO.1 755 CDS 100% 4.950 3.465 N Smoc1 n/a
10 TRCN0000317337 GCCAGGGTAATTCAGGAAGAA pLKO_005 755 CDS 100% 4.950 3.465 N Smoc1 n/a
11 TRCN0000080173 GCTGTCAAAGTCCAGTCACTT pLKO.1 2164 3UTR 100% 4.950 3.465 N Smoc1 n/a
12 TRCN0000317339 GCTGTCAAAGTCCAGTCACTT pLKO_005 2164 3UTR 100% 4.950 3.465 N Smoc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03921 pDONR223 100% 86.3% 92.2% None (many diffs) n/a
2 ccsbBroad304_03921 pLX_304 0% 86.3% 92.2% V5 (many diffs) n/a
3 TRCN0000473133 CCGCCTACCGAGCACTATTTAATT pLX_317 36.6% 86.3% 92.2% V5 (many diffs) n/a
4 TRCN0000489212 TGAGTGTTCGTGGAGTGATAAGGC pLX_317 34.5% 86.3% 92.2% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_03922 pDONR223 100% 86.2% 91.6% None (many diffs) n/a
6 ccsbBroad304_03922 pLX_304 0% 86.2% 91.6% V5 (many diffs) n/a
7 TRCN0000480480 CGACCTGAGAACGGTCAACAAGAT pLX_317 25.2% 86.2% 91.6% V5 (many diffs) n/a
Download CSV