Construct: ORF TRCN0000480517
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016857.1_s317c1
- Derived from:
- ccsbBroadEn_01779
- DNA Barcode:
- GTCATCAACTGTTGTTTTTTCATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WNT5A (7474)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480517
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7474 | WNT5A | Wnt family member 5A | NM_003392.4 | 100% | 100% | |
| 2 | human | 7474 | WNT5A | Wnt family member 5A | XM_017007127.1 | 96.1% | 95.9% | 1_43del;44_45insT;46G>A |
| 3 | human | 7474 | WNT5A | Wnt family member 5A | NM_001256105.1 | 96% | 96% | 0_1ins45 |
| 4 | human | 7474 | WNT5A | Wnt family member 5A | XM_006713324.1 | 96% | 96% | 0_1ins45 |
| 5 | human | 7474 | WNT5A | Wnt family member 5A | XM_011534085.2 | 96% | 96% | 0_1ins45 |
| 6 | human | 7474 | WNT5A | Wnt family member 5A | XM_011534086.2 | 96% | 96% | 0_1ins45 |
| 7 | human | 7474 | WNT5A | Wnt family member 5A | XM_011534087.2 | 96% | 96% | 0_1ins45 |
| 8 | human | 7474 | WNT5A | Wnt family member 5A | XM_011534088.2 | 96% | 96% | 0_1ins45 |
| 9 | human | 7474 | WNT5A | Wnt family member 5A | XM_011534089.1 | 96% | 96% | 0_1ins45 |
| 10 | human | 7474 | WNT5A | Wnt family member 5A | XM_017007128.1 | 96% | 96% | 0_1ins45 |
| 11 | mouse | 22418 | Wnt5a | wingless-type MMTV integrat... | NM_009524.3 | 90% | 98.6% | (many diffs) |
| 12 | mouse | 22418 | Wnt5a | wingless-type MMTV integrat... | XM_006518926.3 | 87.3% | 95.3% | (many diffs) |
| 13 | mouse | 22418 | Wnt5a | wingless-type MMTV integrat... | XM_006518923.3 | 86.9% | 94.9% | (many diffs) |
| 14 | mouse | 22418 | Wnt5a | wingless-type MMTV integrat... | NM_001256224.1 | 85.4% | 94.2% | (many diffs) |
| 15 | mouse | 22418 | Wnt5a | wingless-type MMTV integrat... | XM_006518924.2 | 85.4% | 94.2% | (many diffs) |
| 16 | mouse | 22418 | Wnt5a | wingless-type MMTV integrat... | XM_006518925.3 | 85.4% | 94.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1206
- ORF length:
- 1140
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gaagtccatt ggaatattaa gcccaggagt tgctttgggg atggctggaa 121 gtgcaatgtc ttccaagttc ttcctagtgg ctttggccat atttttctcc ttcgcccagg 181 ttgtaattga agccaattct tggtggtcgc taggtatgaa taaccctgtt cagatgtcag 241 aagtatatat tataggagca cagcctctct gcagccaact ggcaggactt tctcaaggac 301 agaagaaact gtgccacttg tatcaggacc acatgcagta catcggagaa ggcgcgaaga 361 caggcatcaa agaatgccag tatcaattcc gacatcgaag gtggaactgc agcactgtgg 421 ataacacctc tgtttttggc agggtgatgc agataggcag ccgcgagacg gccttcacat 481 acgcggtgag cgcagcaggg gtggtgaacg ccatgagccg ggcgtgccgc gagggcgagc 541 tgtccacctg cggctgcagc cgcgccgcgc gccccaagga cctgccgcgg gactggctct 601 ggggcggctg cggcgacaac atcgactatg gctaccgctt tgccaaggag ttcgtggacg 661 cccgcgagcg ggagcgcatc cacgccaagg gctcctacga gagtgctcgc atcctcatga 721 acctgcacaa caacgaggcc ggccgcagga cggtgtacaa cctggctgat gtggcctgca 781 agtgccatgg ggtgTCCGGC TCATGTAGCC TGAAGACATG CTGGCTGCAG CTGGCAGACT 841 TCCGCAAGGT GGGTGATGCC CTGAAGGAGA AGTACGACAG CGCGGCGGCC ATGCGGCTCA 901 ACAGCCGGGG CAAGTTGGTA CAGGTCAACA GCCGCTTCAA CTCGCCCACC ACACAAGACC 961 TGGTCTACAT CGACCCCAGC CCTGACTACT GCGTGCGCAA TGAGAGCACC GGCTCGCTGG 1021 GCACGCAGGG CCGCCTGTGC AACAAGACGT CGGAGGGCAT GGATGGCTGC GAGCTCATGT 1081 GCTGCGGCCG TGGCTACGAC CAGTTCAAGA CCGTGCAGAC GGAGCGCTGC CACTGCAAGT 1141 TCCACTGGTG CTGCTACGTC AAGTGCAAGA AGTGCACGGA GATCGTGGAC CAGTTTGTGT 1201 GCAAGTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1261 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1321 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGTCATCAAC TGTTGTTTTT TCATAACGCG 1381 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt