Transcript: Mouse XM_006518926.3

PREDICTED: Mus musculus wingless-type MMTV integration site family, member 5A (Wnt5a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wnt5a (22418)
Length:
3803
CDS:
67..1242

Additional Resources:

NCBI RefSeq record:
XM_006518926.3
NBCI Gene record:
Wnt5a (22418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071831 GCTAATTCTTGGTGGTCTCTA pLKO.1 226 CDS 100% 4.950 6.930 N Wnt5a n/a
2 TRCN0000071829 CCACTTGTATCAGGACCACAT pLKO.1 348 CDS 100% 4.050 5.670 N Wnt5a n/a
3 TRCN0000062714 CCTGTTCAGATGTCAGAAGTA pLKO.1 259 CDS 100% 4.950 3.465 N WNT5A n/a
4 TRCN0000288987 CCTGTTCAGATGTCAGAAGTA pLKO_005 259 CDS 100% 4.950 3.465 N WNT5A n/a
5 TRCN0000071828 CGCTAGAGAAAGGGAACGAAT pLKO.1 693 CDS 100% 4.950 3.465 N Wnt5a n/a
6 TRCN0000071830 GTGGATCAGTTCGTGTGCAAA pLKO.1 1219 CDS 100% 4.950 3.465 N Wnt5a n/a
7 TRCN0000071832 CCAAGTTCTTCCTAATGGCTT pLKO.1 167 CDS 100% 2.640 1.584 N Wnt5a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518926.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01779 pDONR223 100% 87.3% 95.3% None (many diffs) n/a
2 ccsbBroad304_01779 pLX_304 57.5% 87.3% 95.3% V5 (many diffs) n/a
3 TRCN0000480517 GTCATCAACTGTTGTTTTTTCATA pLX_317 36.3% 87.3% 95.3% V5 (many diffs) n/a
Download CSV