Construct: ORF TRCN0000480558
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010783.2_s317c1
- Derived from:
- ccsbBroadEn_00837
- DNA Barcode:
- GCTCCCGCTGTCCGCAGACACCAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IGFBP4 (3487)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480558
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3487 | IGFBP4 | insulin like growth factor ... | NM_001552.3 | 99.8% | 100% | 774delG |
| 2 | mouse | 16010 | Igfbp4 | insulin-like growth factor ... | NM_010517.3 | 88.7% | 90.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 840
- ORF length:
- 774
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gcccctctgc ctcgtggccg ccctgctgct ggccgccggg cccgggccga 121 gcctgggcga cgaagccatc cactgcccgc cctgctccga ggagaagctg gcgcgctgcc 181 gcccccccgt gggctgcgag gagctggtgc gagagccggg ctgcggctgt tgcgccactt 241 gcgccctggg cttggggatg ccctgcgggg tgtacacccc ccgttgcggc tcgggcctgc 301 gctgctaccc gccccgaggg gtggagaagc ccctgcacac actgatgcac gggcaaggcg 361 tgtgcatgga gctggcggag atcgaggcca tccaggaaag cctgcagccc TCTGACAAGG 421 ACGAGGGTGA CCACCCCAAC AACAGCTTCA GCCCCTGTAG CGCCCATGAC CGCAGGTGCC 481 TGCAGAAGCA CTTCGCCAAA ATTCGAGACC GGAGCACCAG TGGGGGCAAG ATGAAGGTCA 541 ATGGGGCGCC CCGGGAGGAT GCCCGGCCTG TGCCCCAGGG CTCCTGCCAG AGCGAGCTGC 601 ACCGGGCGCT GGAGCGGCTG GCCGCTTCAC AGAGCCGCAC CCACGAGGAC CTCTACATCA 661 TCCCCATCCC CAACTGCGAC CGCAACGGCA ACTTCCACCC CAAGCAGTGT CACCCAGCTC 721 TGGATGGGCA GCGTGGCAAG TGCTGGTGTG TGGACCGGAA GACGGGGGTG AAGCTTCCGG 781 GGGGCCTGGA GCCAAAGGGG GAGCTGGACT GCCACCAGCT GGCTGACAGC TTTCGAGAGG 841 CCCACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT 901 CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT 961 TATATATCTT GTGGAAAGGA CGAGCTCCCG CTGTCCGCAG ACACCACACG CGTTAAGTCg 1021 acaatcaacc tctggattac aaaatttgtg aaagatt