Transcript: Mouse NM_010517.3

Mus musculus insulin-like growth factor binding protein 4 (Igfbp4), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Igfbp4 (16010)
Length:
2069
CDS:
238..1002

Additional Resources:

NCBI RefSeq record:
NM_010517.3
NBCI Gene record:
Igfbp4 (16010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010517.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114799 CGTACATTGATGCACGGGCAA pLKO.1 508 CDS 100% 2.160 3.024 N Igfbp4 n/a
2 TRCN0000114797 CATTCCAAACTGTGACCGCAA pLKO.1 825 CDS 100% 2.160 1.728 N Igfbp4 n/a
3 TRCN0000320173 CATTCCAAACTGTGACCGCAA pLKO_005 825 CDS 100% 2.160 1.728 N Igfbp4 n/a
4 TRCN0000114796 CCCTACCCTTATACCTCCTAT pLKO.1 1921 3UTR 100% 4.950 3.465 N Igfbp4 n/a
5 TRCN0000320113 CCCTACCCTTATACCTCCTAT pLKO_005 1921 3UTR 100% 4.950 3.465 N Igfbp4 n/a
6 TRCN0000114798 GACAAGGATGAGAGCGAACAT pLKO.1 586 CDS 100% 4.950 3.465 N Igfbp4 n/a
7 TRCN0000320111 GACAAGGATGAGAGCGAACAT pLKO_005 586 CDS 100% 4.950 3.465 N Igfbp4 n/a
8 TRCN0000114800 GCTGCGGTTGTTGCGCCACTT pLKO.1 392 CDS 100% 0.000 0.000 N Igfbp4 n/a
9 TRCN0000350214 GCTGCGGTTGTTGCGCCACTT pLKO_005 392 CDS 100% 0.000 0.000 N Igfbp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010517.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00837 pDONR223 100% 88.9% 90.6% None (many diffs) n/a
2 ccsbBroad304_00837 pLX_304 0% 88.9% 90.6% V5 (many diffs) n/a
3 TRCN0000480558 GCTCCCGCTGTCCGCAGACACCAC pLX_317 55.3% 88.7% 90.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV