Construct: ORF TRCN0000480586
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015198.2_s317c1
- Derived from:
- ccsbBroadEn_03625
- DNA Barcode:
- GAATGGGCGATAGGGCAGGTGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HIF1AN (55662)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480586
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55662 | HIF1AN | hypoxia inducible factor 1 ... | NM_017902.3 | 100% | 100% | |
2 | human | 55662 | HIF1AN | hypoxia inducible factor 1 ... | XM_011539940.2 | 94.5% | 94.5% | 175_234del |
3 | human | 55662 | HIF1AN | hypoxia inducible factor 1 ... | XM_011539941.1 | 69.3% | 69.3% | 0_1ins321 |
4 | mouse | 319594 | Hif1an | hypoxia-inducible factor 1,... | NM_176958.3 | 91.1% | 97.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1113
- ORF length:
- 1047
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcgacagcg gcggaggctg tggcctctgg ctctggagag ccccgggagg 121 aggctggagc cctcggcccc gcctgggatg aatcccagtt gcgcagttat agcttcccga 181 ctaggcccat tccgcgtctg agtcagagcg acccccgggc agaggagctt attgagaatg 241 aggagcctgt ggtgctgacc gacacaaatc ttgtgtatcc tgccctgaaa tgggaccttg 301 aatacctgca agagaatatt ggcaatggag acttctctgt gtacagtgcc agcacccaca 361 agttcttgta ctatgatgag aagaagatgg ccaatttcca gaactttaag ccgaggtcca 421 acagggaaga aatgaaattt catgagttcg ttgagaaact gcaggatata cagcagcgag 481 gaggggaaga gaggttgtat ctgcagcaaa cgctcaatga cactgtgggc aggaagattg 541 tcatggactt cttaggtttt aactggaact ggattaataa gcaacaggga aagcgtggct 601 gggggcagct tacctctaac ctgctgctca ttggcatgga aggaaatgtg acacctgctc 661 actatgatga gcagcagaac ttttttgctc agataaaagg ttacaaacga tgcatcttat 721 tcccTCCGGA TCAGTTCGAG TGCCTCTACC CATACCCTGT TCATCACCCA TGTGACAGAC 781 AGAGCCAGGT GGACTTTGAC AATCCCGACT ACGAGAGGTT CCCTAATTTC CAAAATGTGG 841 TTGGTTACGA AACAGTGGTT GGCCCTGGTG ATGTTCTTTA CATCCCAATG TACTGGTGGC 901 ATCACATAGA GTCATTACTA AATGGGGGGA TTACCATCAC TGTGAACTTC TGGTATAAGG 961 GGGCTCCCAC CCCTAAGAGA ATTGAATATC CTCTCAAAGC TCATCAGAAA GTGGCCATAA 1021 TGAGAAACAT TGAGAAGATG CTTGGAGAGG CCTTGGGGAA CCCACAAGAG GTGGGGCCCT 1081 TGTTGAACAC AATGATCAAG GGCCGATACA ACTACCCAAC TTTCTTGTAC AAAGTGGTTG 1141 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1201 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGA 1261 ATGGGCGATA GGGCAGGTGC CAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1321 ttgtgaaaga tt