Transcript: Human XM_011539941.1

PREDICTED: Homo sapiens hypoxia inducible factor 1 subunit alpha inhibitor (HIF1AN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HIF1AN (55662)
Length:
6786
CDS:
275..1003

Additional Resources:

NCBI RefSeq record:
XM_011539941.1
NBCI Gene record:
HIF1AN (55662)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236152 CTACGAGAGGTTCCCTAATTT pLKO_005 697 CDS 100% 15.000 21.000 N HIF1AN n/a
2 TRCN0000236150 TCACATAGAGTCATTACTAAA pLKO_005 790 CDS 100% 13.200 18.480 N HIF1AN n/a
3 TRCN0000236151 TGAAGCAACCAGAGGTTATAA pLKO_005 4667 3UTR 100% 15.000 10.500 N HIF1AN n/a
4 TRCN0000236149 TTTAACTGGAACTGGATTAAT pLKO_005 446 CDS 100% 15.000 10.500 N HIF1AN n/a
5 TRCN0000064826 CCCTGAAATGGGACCTTGAAT pLKO.1 171 5UTR 100% 5.625 3.938 N HIF1AN n/a
6 TRCN0000064824 CCCTGGTGATGTTCTTTACAT pLKO.1 751 CDS 100% 5.625 3.938 N HIF1AN n/a
7 TRCN0000064823 GCCCTTGTTGAACACAATGAT pLKO.1 964 CDS 100% 5.625 3.938 N HIF1AN n/a
8 TRCN0000175704 GAAGATTGTCATGGACTTCTT pLKO.1 421 CDS 100% 4.950 3.465 N Hif1an n/a
9 TRCN0000064827 GAGAATTGAATATCCTCTCAA pLKO.1 865 CDS 100% 4.950 3.465 N HIF1AN n/a
10 TRCN0000173743 CCTGCAAGAGAATATTGGCAA pLKO.1 193 5UTR 100% 2.640 1.848 N Hif1an n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03625 pDONR223 100% 69.3% 69.3% None 0_1ins321 n/a
2 ccsbBroad304_03625 pLX_304 64.1% 69.3% 69.3% V5 0_1ins321 n/a
3 TRCN0000480586 GAATGGGCGATAGGGCAGGTGCCA pLX_317 37.3% 69.3% 69.3% V5 0_1ins321 n/a
Download CSV