Construct: ORF TRCN0000480625
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016399.1_s317c1
- Derived from:
- ccsbBroadEn_10015
- DNA Barcode:
- AGGGCAAAACTGGCAGCGGACACG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- C1orf174 (339448)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480625
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 339448 | C1orf174 | chromosome 1 open reading f... | NM_207356.3 | 99.8% | 99.5% | 158C>G |
2 | human | 339448 | C1orf174 | chromosome 1 open reading f... | XM_005244743.3 | 86.9% | 77.6% | (many diffs) |
3 | human | 339448 | C1orf174 | chromosome 1 open reading f... | XM_011541323.2 | 86.9% | 77.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 795
- ORF length:
- 729
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gagccggaag ctcacaggtg cagtgcggtc ttcagcgcgc ttgaaagcac 121 gaagttgttc ggcagccagg ttggcctctg cccaggaagt tgctggttcc acgtctgcca 181 agacagcatg tctgacttcc tcatcccaca aagccacaga caggcgaacg tccaagaagt 241 tcaaatgtga caaaggacat cttgtgaagt cagaattaca gaagcttgtc cctaagaatg 301 acagcgcttc tttgccaaaa gtgacacctg agaccccttg tgaaaatgag tttgctgaag 361 gcagtgcctt gcttccaggc agcgaggctg gcgtttctgt gcagcagggg gctgcaagTC 421 TTCCTCTCGG TGGCTGCAGA GTTGTGAGTG ACTCTCGCTT AGCAAAGACT AGAGATGGCC 481 TGTCCGTGCC AAAACACAGT GCCGGGTCCG GAGCAGAAGA ATCCAACAGC AGCTCCACTG 541 TGCAGAAGCA GAATGAGCCA GGGCTACAGA CAGAGGATGT GCAGAAGCCA CCACTTCAGA 601 TGGACAACAG CGTCTTTCTA GATGACGACA GCAATCAGCC AATGCCCGTG AGCCGGTTCT 661 TTGGAAACGT TGAGCTCATG CAGGACCTCC CACCTGCGTC TTCATCTTGT CCTTCAATGA 721 GCAGACGAGA GTTCAGAAAA ATGCATTTCA GAGCCAAAGA TGATGATGAT GACGACGACG 781 ATGATGCAGA AATGTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 841 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 901 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA AGGGCAAAAC TGGCAGCGGA 961 CACGACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt