Construct: ORF TRCN0000480660
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012362.1_s317c1
- Derived from:
- ccsbBroadEn_11730
- DNA Barcode:
- GGACATAATCACATTTTGACCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KIAA0895 (23366)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480660
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23366 | KIAA0895 | KIAA0895 | NM_001199707.2 | 58.7% | 55.2% | (many diffs) |
| 2 | human | 23366 | KIAA0895 | KIAA0895 | XM_005249689.3 | 53.2% | 51.2% | (many diffs) |
| 3 | human | 23366 | KIAA0895 | KIAA0895 | NM_001100425.2 | 52.5% | 45.7% | (many diffs) |
| 4 | human | 23366 | KIAA0895 | KIAA0895 | NM_015314.3 | 50.6% | 46.1% | (many diffs) |
| 5 | human | 23366 | KIAA0895 | KIAA0895 | NM_001199706.2 | 45.9% | 42.9% | (many diffs) |
| 6 | human | 23366 | KIAA0895 | KIAA0895 | XM_024446702.1 | 31.6% | 28% | (many diffs) |
| 7 | human | 23366 | KIAA0895 | KIAA0895 | NM_001199708.2 | 28.4% | 26.4% | (many diffs) |
| 8 | human | 23366 | KIAA0895 | KIAA0895 | XM_024446701.1 | 28.4% | 26.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 981
- ORF length:
- 912
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggtagccacc ggctgggcgc gccgctcggg actccaccct gcgccccgac 121 cccttcgggg cgcgcaggag gcgctcgcga aaaacctgtg gagggaagag agaaatcggc 181 cccttatcct ttcgtcactt attatcaaaa agcttcactg gcctgagcaa gaacttgcta 241 agaagtctat tctaaatgca gaagattcat tgatcattga caacaaaaga agcatttcac 301 atttgtcctc gggagtgcta aaagacattt tcacaactgg aaccagtagt tacaatgtcc 361 tactacagag caaggaggaa aaaaagtatc attcacaaaa acagtcttcc tccacctact 421 ccaaaagatg tagaaaaccc agcaaatctc ctaacacttc tcgtagcaaa gatcctcgca 481 ggatgaaagc cctggtgcct gtgacaagca gtggtacttg gtactgcctg gagaggcggc 541 cTGCTGTTTT TGTCACTAGT TCAGTGTCAA GTCCTGTAAA GTTTACACAT GATATCTCTG 601 TTACAGGGAA TGGCATAGTA CTGCCACCTA AACCCAAAAG CAAGGTCAAG TGGTGCCATT 661 TCTCCACTCT TCCAAAGCCA AAGCCTCAGC TGTCTAGAAG CTTTGAAAAG GGAGATGACT 721 TTTCTGGGAA GAAATTTTGT ATATTGACTG CTATAAAACC CACCAACTTA GAGAAAGAAA 781 AACTGAGATT CTTCAAATCT GACTATACCT ACAATCCTCA GTTTGAGTAT GCCAATCCTG 841 CTCTGCCAAG CGTATTAGCT AAGCATAGCC ACGCATCTGA CCGATTTCTT AAGCAGGTAA 901 AATGCCATTT CAATAGTGGT AGTTCATTTT TATGTACTAA AACAATTATC TGTGATCTTA 961 TAAGCAAAAA CAAAGACATT TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1021 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1081 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGGAC ATAATCACAT 1141 TTTGACCTCG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt