Transcript: Human XM_005249689.3

PREDICTED: Homo sapiens KIAA0895 (KIAA0895), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0895 (23366)
Length:
4603
CDS:
397..2064

Additional Resources:

NCBI RefSeq record:
XM_005249689.3
NBCI Gene record:
KIAA0895 (23366)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149467 GTTACAGGGAATGGCATAGTA pLKO.1 928 CDS 100% 5.625 4.500 N KIAA0895 n/a
2 TRCN0000148807 CCAGGTATACTTGGATGGAAT pLKO.1 1824 CDS 100% 4.950 3.465 N KIAA0895 n/a
3 TRCN0000127952 CCTCAGTTTGAGTATGCCAAT pLKO.1 1144 CDS 100% 4.050 2.835 N KIAA0895 n/a
4 TRCN0000127593 CCAGCAAATCTCCTAACACTT pLKO.1 767 CDS 100% 4.950 2.970 N KIAA0895 n/a
5 TRCN0000149960 GCAGTTCTAGTTCCTGACTTT pLKO.1 3944 3UTR 100% 4.950 2.970 N KIAA0895 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249689.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11730 pDONR223 100% 53.2% 51.2% None (many diffs) n/a
2 ccsbBroad304_11730 pLX_304 0% 53.2% 51.2% V5 (many diffs) n/a
3 TRCN0000480660 GGACATAATCACATTTTGACCTCG pLX_317 48.1% 53.2% 51.2% V5 (many diffs) n/a
Download CSV