Construct: ORF TRCN0000480740
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003015.5_s317c1
- Derived from:
- ccsbBroadEn_04308
- DNA Barcode:
- TCTGCGAACATCTCTTTCGATATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- STK40 (83931)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480740
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 83931 | STK40 | serine/threonine kinase 40 | NM_001282547.2 | 100% | 100% | |
2 | human | 83931 | STK40 | serine/threonine kinase 40 | NM_032017.3 | 100% | 100% | |
3 | human | 83931 | STK40 | serine/threonine kinase 40 | NM_001282546.2 | 98.8% | 98.8% | 112_126del |
4 | mouse | 74178 | Stk40 | serine/threonine kinase 40 | NM_028800.3 | 89.8% | 97.2% | (many diffs) |
5 | mouse | 74178 | Stk40 | serine/threonine kinase 40 | XM_006503442.1 | 89.8% | 97.2% | (many diffs) |
6 | mouse | 74178 | Stk40 | serine/threonine kinase 40 | XM_017320414.1 | 89.8% | 97.2% | (many diffs) |
7 | mouse | 74178 | Stk40 | serine/threonine kinase 40 | NM_001145827.1 | 87% | 94.2% | (many diffs) |
8 | mouse | 74178 | Stk40 | serine/threonine kinase 40 | XM_006503441.3 | 87% | 94.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1371
- ORF length:
- 1305
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gcggagagca tcagacagag gagctgggga aacgtcggcc agggccaagg 121 ctctaggaag tgggatttct ggaaataatg caaagagagc tggaccattc atccttggtc 181 cccgtctggg caactcaccg gtgccaagca tagtgcagtg tttggcgagg aaagatggca 241 cggatgactt ctatcagctg aagatcctga ccctggagga gaggggggac caaggcatag 301 agagccagga agagcggcag ggcaagatgc tgctgcacac cgagtactca ctgctgtctc 361 tcctgcacac gcaggatggc gtggtgcacc accacggcct cttccaggac cgcacctgtg 421 aaatcgttga ggacacagaa tccagccgga tggttaagaa gatgaagaag cgcatctgcc 481 tcgtcctgga ctgcctctgt gctcatgact tcagcgataa gaccgctgac ctcatcaacc 541 tgcagcacta cgtcatcaag gagaagaggc tcagcgagag ggagactgtg gtaatcttct 601 acgacgtggt ccgcgtggtg gaggccctgc accagaaaaa tatcgtgcac agagacctga 661 agctggggaa catggtgctc aacaagagga cacatcggat aaccatcacc aacttctgcc 721 tcgggaagca tctggtgagc gagggggacc tgctgaagga ccagagaggg agccctgcct 781 acatcagtcc cgacgtgctc agcggccggc cgtaccgtgg caagcccagt gacatgtggg 841 ccctgggcgt ggtgctcttc accatgctgt atggccagtt ccccttctac gacagcatcc 901 cgcaggagct cttccgcaag atcaaggctg ccgagtatac cattcctgag gatggacggg 961 tttctgagaa caccgtgtgt ctcaTCCGGA AGCTGCTGGT CCTTGACCCC CAGCAGCGCC 1021 TGGCCGCCGC CGACGTCCTG GAGGCCCTCA GTGCCATCAT TGCATCATGG CAGTCCCTGT 1081 CATCTCTGAG TGGGCCTTTG CAAGTGGTTC CTGACATTGA TGACCAAATG AGCAATGCGG 1141 ATAGCTCCCA GGAGGCGAAG GTGACGGAGG AGTGCTCCCA GTACGAGTTT GAGAACTACA 1201 TGCGTCAGCA GCTGCTGCTG GCCGAGGAGA AGAGCTCCAT CCATGACGCC CGGAGCTGGG 1261 TACCCAAGCG GCAGTTCGGC AGCGCACCAC CGGTGCGACG GCTGGGCCAC GACGCACAGC 1321 CCATGACCTC CTTGGACACG GCCATCCTGG CGCAGCGCTA CCTGCGGAAA TACCCAACTT 1381 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1441 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1501 CTTGTGGAAA GGACGATCTG CGAACATCTC TTTCGATATC ACGCGTTAAG TCgacaatca 1561 acctctggat tacaaaattt gtgaaagatt