Construct: ORF TRCN0000480801
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013691.1_s317c1
- Derived from:
- ccsbBroadEn_06978
- DNA Barcode:
- AGGAGTCTAGTTGAAATAGATTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SMN2 (6607)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480801
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6607 | SMN2 | survival of motor neuron 2,... | NM_017411.4 | 99.8% | 100% | 462A>G |
| 2 | human | 6606 | SMN1 | survival of motor neuron 1,... | NM_000344.3 | 99.7% | 100% | 462A>G;840C>T |
| 3 | human | 6607 | SMN2 | survival of motor neuron 2,... | XM_017009787.1 | 96.2% | 95.5% | (many diffs) |
| 4 | human | 6606 | SMN1 | survival of motor neuron 1,... | NM_001297715.1 | 95.5% | 94.5% | (many diffs) |
| 5 | human | 6607 | SMN2 | survival of motor neuron 2,... | NM_022875.3 | 95.5% | 94.5% | (many diffs) |
| 6 | human | 6606 | SMN1 | survival of motor neuron 1,... | XM_011543596.1 | 95.5% | 94.6% | (many diffs) |
| 7 | human | 6607 | SMN2 | survival of motor neuron 2,... | XM_011543599.1 | 95.5% | 94.6% | (many diffs) |
| 8 | human | 6607 | SMN2 | survival of motor neuron 2,... | NM_022876.2 | 89% | 89.1% | 462A>G;627_628ins96 |
| 9 | human | 6606 | SMN1 | survival of motor neuron 1,... | NM_022874.2 | 88.8% | 89.1% | 462A>G;627_628ins96;744C>T |
| 10 | human | 6607 | SMN2 | survival of motor neuron 2,... | NM_022877.2 | 84.6% | 83.6% | (many diffs) |
| 11 | human | 6606 | SMN1 | survival of motor neuron 1,... | XM_017009786.1 | 84.6% | 83.6% | (many diffs) |
| 12 | human | 6607 | SMN2 | survival of motor neuron 2,... | XM_011543600.2 | 77.2% | 77.2% | 271_272ins201 |
| 13 | human | 6606 | SMN1 | survival of motor neuron 1,... | XM_011543597.1 | 77% | 77.2% | 271_272ins201;639C>T |
| 14 | human | 6607 | SMN2 | survival of motor neuron 2,... | XM_011543601.1 | 72.9% | 71.7% | (many diffs) |
| 15 | human | 6607 | SMN2 | survival of motor neuron 2,... | XM_011543602.3 | 66.3% | 66.3% | 271_272ins201;426_427ins96 |
| 16 | human | 6606 | SMN1 | survival of motor neuron 1,... | XM_011543598.3 | 66.2% | 66.3% | 271_272ins201;426_427ins96;543C>T |
| 17 | human | 6607 | SMN2 | survival of motor neuron 2,... | XM_011543603.3 | 62% | 60.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 948
- ORF length:
- 882
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gatgagcagc ggcggcagtg gtggcggcgt cccggagcag gaggattccg 121 tgctgttccg gcgcggcaca ggccagagcg atgattctga catttgggat gatacagcac 181 tgataaaagc atatgataaa gctgtggctt catttaagca tgctctaaag aatggtgaca 241 tttgtgaaac ttcgggtaaa ccaaaaacca cacctaaaag aaaacctgct aagaagaata 301 aaagccaaaa gaagaatact gcagcttcct tacaacagtg gaaagttggg gacaaatgtt 361 ctgccatttg gtcagaagac ggttgcattt acccagctac cattgcttca attgatttta 421 agagagaaac ctgtgttgtg gtttacactg gatatggaaa tagagaggag caaaatctgt 481 ccgatctact ttccccaatc tgtgaagtag ctaataatat agaacagaat gctcaagaga 541 atgaaaatga aagccaagtt tcaacagatG AAAGTGAGAA CTCCAGGTCT CCTGGAAATA 601 AATCAGATAA CATCAAGCCC AAATCTGCTC CATGGAACTC TTTTCTCCCT CCACCACCCC 661 CCATGCCAGG GCCAAGACTG GGACCAGGAA AGCCAGGTCT AAAATTCAAT GGCCCACCAC 721 CGCCACCGCC ACCACCACCA CCCCACTTAC TATCATGCTG GCTGCCTCCA TTTCCTTCTG 781 GACCACCAAT AATTCCCCCA CCACCTCCCA TATGTCCAGA TTCTCTTGAT GATGCTGATG 841 CTTTGGGAAG TATGTTAATT TCATGGTACA TGAGTGGCTA TCATACTGGC TATTATATGG 901 GTTTTAGACA AAATCAAAAA GAAGGAAGGT GCTCACATTC CTTAAATTAC CCAACTTTCT 961 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1021 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1081 GTGGAAAGGA CGAAGGAGTC TAGTTGAAAT AGATTAAACG CGTTAAGTCg acaatcaacc 1141 tctggattac aaaatttgtg aaagatt