Transcript: Human NM_017411.4

Homo sapiens survival of motor neuron 2, centromeric (SMN2), transcript variant d, mRNA.

Source:
NCBI, updated 2019-08-24
Taxon:
Homo sapiens (human)
Gene:
SMN2 (6607)
Length:
1482
CDS:
18..902

Additional Resources:

NCBI RefSeq record:
NM_017411.4
NBCI Gene record:
SMN2 (6607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017411.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359455 ATCTGTGAAGTAGCTAATAAT pLKO_005 450 CDS 100% 15.000 7.500 Y SMN1 n/a
2 TRCN0000359298 GCTATCATACTGGCTATTATA pLKO_005 829 CDS 100% 15.000 7.500 Y SMN2 n/a
3 TRCN0000359382 GGCTATCATACTGGCTATTAT pLKO_005 828 CDS 100% 15.000 7.500 Y SMN1 n/a
4 TRCN0000359379 GGGTAACTCTTCTTGATTAAA pLKO_005 1046 3UTR 100% 15.000 7.500 Y SMN2 n/a
5 TRCN0000359367 CAATCTGTGAAGTAGCTAATA pLKO_005 448 CDS 100% 13.200 6.600 Y SMN2 n/a
6 TRCN0000118702 GCACTAAATGACACCACTAAA pLKO.1 925 3UTR 100% 13.200 6.600 Y SMN1 n/a
7 TRCN0000359297 TCTGGAATGTGAAGCGTTATA pLKO_005 962 3UTR 100% 13.200 6.600 Y SMN2 n/a
8 TRCN0000118704 CAGAGCGATGATTCTGACATT pLKO.1 96 CDS 100% 4.950 2.475 Y SMN1 n/a
9 TRCN0000118706 CCCAATCTGTGAAGTAGCTAA pLKO.1 446 CDS 100% 4.950 2.475 Y SMN1 n/a
10 TRCN0000118952 GCATTTAGGAATGAAGTGTTA pLKO.1 1295 3UTR 100% 4.950 2.475 Y SMN2 n/a
11 TRCN0000118954 GCTCTAAAGAATGGTGACATT pLKO.1 174 CDS 100% 4.950 2.475 Y SMN2 n/a
12 TRCN0000118703 GCTTCCTTACAACAGTGGAAA pLKO.1 276 CDS 100% 4.950 2.475 Y SMN1 n/a
13 TRCN0000118705 TCATGGTACATGAGTGGCTAT pLKO.1 813 CDS 100% 4.050 2.025 Y SMN1 n/a
14 TRCN0000118956 AGCTTCCTTACAACAGTGGAA pLKO.1 275 CDS 100% 2.640 1.320 Y SMN2 n/a
15 TRCN0000118955 CCACTTACTATCATGCTGGCT pLKO.1 695 CDS 100% 0.660 0.330 Y SMN2 n/a
16 TRCN0000118953 GCCAAGTTTCAACAGATGAAA pLKO.1 505 CDS 100% 0.563 0.281 Y SMN2 n/a
17 TRCN0000359456 TACCATTGCTTCAATTGATTT pLKO_005 350 CDS 100% 0.000 0.000 Y SMN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017411.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06978 pDONR223 100% 99.8% 100% None 462A>G n/a
2 ccsbBroad304_06978 pLX_304 0% 99.8% 100% V5 462A>G n/a
3 TRCN0000480801 AGGAGTCTAGTTGAAATAGATTAA pLX_317 43.1% 99.8% 100% V5 462A>G n/a
4 ccsbBroadEn_06977 pDONR223 100% 95.5% 94.5% None (many diffs) n/a
5 ccsbBroad304_06977 pLX_304 0% 95.5% 94.5% V5 (many diffs) n/a
Download CSV