Construct: ORF TRCN0000480842
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012053.1_s317c1
- Derived from:
- ccsbBroadEn_04599
- DNA Barcode:
- CGCTGCTTCACAAATATCCACTAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MVB12A (93343)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480842
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 93343 | MVB12A | multivesicular body subunit... | NM_138401.4 | 100% | 100% | |
| 2 | human | 93343 | MVB12A | multivesicular body subunit... | NM_001304547.2 | 66.3% | 66.3% | 0_1ins276 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 885
- ORF length:
- 819
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tcccgtaccc gggacagact cggcgccgct ggctggcctg gcctggtcgt 121 cggcctctgc acccccgccg cgggggttca gcgcgatctc ctgcaccgtc gagggggcac 181 ccgccagctt tggcaagagc ttcgcgcaga aatctggcta cttcctgtgc cttagttctc 241 tgggcagcct agagaacccg caggagaacg tggtggccga tatccagatc gtggtggaca 301 agagccccct gccgctgggc ttctcccccg tctgcgaccc catggattcc aaggcctctg 361 tgtccaagaa gaaacgcatg tgtgtgaagc tgttgcccct gggagccacg gacacggctg 421 tgtttgatgt ccggctgagt gggaagacca agacagtgcc tggataccTT CGAATAGGGG 481 ACATGGGCGG CTTTGCCATC TGGTGCAAGA AGGCCAAGGC CCCGAGGCCA GTGCCCAAGC 541 CCCGAGGTCT CAGCCGGGAC ATGCAGGGCC TCTCTCTGGA TGCAGCCAGC CAGCCAAGTA 601 AGGGCGGCCT CCTGGAGCGG ACAGCGTCAA GGCTGGGCTC TCGGGCATCC ACTCTGCGGA 661 GGAATGACTC CATCTACGAG GCCTCCAGCC TCTATGGCAT CTCAGCCATG GATGGGGTTC 721 CCTTCACACT CCACCCACGA TTTGAGGGCA AGAGCTGCAG CCCCCTGGCC TTCTCTGCTT 781 TTGGGGACCT GACCATCAAG TCTCTGGCGG ACATTGAGGA GGAGTATAAC TACGGCTTCG 841 TGGTGGAGAA GACCGCGGCT GCCCGCCTGC CCCCCAGCGT CTCATACCCA ACTTTCTTGT 901 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 961 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1021 GAAAGGACGA CGCTGCTTCA CAAATATCCA CTATACGCGT TAAGTCgaca atcaacctct 1081 ggattacaaa atttgtgaaa gatt