Transcript: Human NM_138401.4

Homo sapiens multivesicular body subunit 12A (MVB12A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MVB12A (93343)
Length:
1250
CDS:
90..911

Additional Resources:

NCBI RefSeq record:
NM_138401.4
NBCI Gene record:
MVB12A (93343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165374 GCAAGGCGTTTGCTATCTTCA pLKO.1 1031 3UTR 100% 4.950 6.930 N MVB12A n/a
2 TRCN0000166318 CTTTGCCATCTGGTGCAAGAA pLKO.1 515 CDS 100% 4.950 3.960 N MVB12A n/a
3 TRCN0000264309 CTTTGCCATCTGGTGCAAGAA pLKO_005 515 CDS 100% 4.950 3.960 N Mvb12a n/a
4 TRCN0000164851 CGTTTGCTATCTTCAGCCACT pLKO.1 1037 3UTR 100% 2.160 1.728 N MVB12A n/a
5 TRCN0000166188 CGGACATTGAGGAGGAGTATA pLKO.1 832 CDS 100% 13.200 9.240 N MVB12A n/a
6 TRCN0000162311 CATTGAGGAGGAGTATAACTA pLKO.1 836 CDS 100% 5.625 3.938 N MVB12A n/a
7 TRCN0000165067 GCTACTTCCTGTGCCTTAGTT pLKO.1 241 CDS 100% 5.625 3.938 N MVB12A n/a
8 TRCN0000165400 CTACTTCCTGTGCCTTAGTTC pLKO.1 242 CDS 100% 4.950 3.465 N MVB12A n/a
9 TRCN0000165483 GAAACGCATGTGTGTGAAGCT pLKO.1 395 CDS 100% 2.640 1.848 N MVB12A n/a
10 TRCN0000165919 GCAGAAATCTGGCTACTTCCT pLKO.1 230 CDS 100% 2.640 1.848 N MVB12A n/a
11 TRCN0000164941 GCCTCTGTGTCCAAGAAGAAA pLKO.1 378 CDS 100% 5.625 3.375 N MVB12A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138401.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04599 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04599 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480842 CGCTGCTTCACAAATATCCACTAT pLX_317 50.8% 100% 100% V5 n/a
4 TRCN0000487711 CCATCTCGCTTTGTGCTCGATCAT pLX_317 29.7% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV