Construct: ORF TRCN0000481076
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014780.1_s317c1
- Derived from:
- ccsbBroadEn_01538
- DNA Barcode:
- ATCTGGTAATGTTGATAATACCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SKP2 (6502)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481076
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6502 | SKP2 | S-phase kinase associated p... | NM_032637.4 | 100% | 100% | |
| 2 | human | 6502 | SKP2 | S-phase kinase associated p... | NM_005983.4 | 87.5% | 82.2% | (many diffs) |
| 3 | human | 6502 | SKP2 | S-phase kinase associated p... | XM_011514082.3 | 87.1% | 86.3% | (many diffs) |
| 4 | human | 6502 | SKP2 | S-phase kinase associated p... | XR_001742203.2 | 69.9% | 1_196del;1258_1470del;1556_1557ins83 | |
| 5 | human | 6502 | SKP2 | S-phase kinase associated p... | XM_017009753.1 | 58.7% | 58.7% | 0_1ins507 |
| 6 | human | 6502 | SKP2 | S-phase kinase associated p... | XM_011514083.3 | 49.2% | 44.3% | (many diffs) |
| 7 | human | 6502 | SKP2 | S-phase kinase associated p... | NM_001243120.1 | 38.9% | 34.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1296
- ORF length:
- 1230
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca caggaagcac ctccaggaga ttccagacct gagtagcaac gttgccacca 121 gcttcacgtg gggatgggat tccagcaaga cttctgaact gctgtcaggc atgggggtct 181 ccgccctgga gaaagaggag cccgacagtg agaacatccc ccaggaactg ctctcaaacc 241 tgggccaccc ggagagcccc ccacggaaac ggctgaagag caaagggagt gacaaagact 301 ttgtgattgt ccgcaggcct aagctaaatc gagagaactt tccaggtgtt tcatgggact 361 cccttccgga tgagctgctc ttgggaatct tttcctgtct gtgcctccct gagctgctaa 421 aggtctctgg tgtttgtaag aggtggtatc gcctagcgtc tgatgagtct ctatggcaga 481 ccttagacct cacaggtaaa aatctgcacc cggatgtgac tggtcggttg ctgtctcaag 541 gggtgattgc cttccgctgc ccacgatcat ttatggacca accattggct gaacatttca 601 gcccttttcg tgtacagcac atggacctat cgaactcagt tatagaagtg tccaccctcc 661 acggcatact gtctcagtgt tccaagttgc agaatctaag cctggaaggc ctgcggcttt 721 cggatcccat tgtcaatact ctcgcaaaaa actcaaattt agtgcgactt aacctttctg 781 ggtgttctgg attctctgaa tttgccctgc agactttgct aagcagctgt tccagactgg 841 atgagctgaa cctctccTGG TGTTTTGATT TCACTGAAAA GCATGTACAG GTGGCTGTTG 901 CGCATGTGTC AGAGACCATC ACCCAGCTGA ATCTTAGCGG CTACAGAAAG AATCTCCAGA 961 AATCAGATCT CTCTACTTTA GTTAGAAGAT GCCCCAATCT TGTCCATCTA GACTTAAGTG 1021 ATAGTGTCAT GCTAAAGAAT GACTGCTTTC AGGAATTTTT CCAGCTCAAC TACCTCCAAC 1081 ACCTATCACT CAGTCGGTGC TATGATATAA TACCTGAAAC TTTACTATTA GTGACAAGAG 1141 CTGGGGTTAG GATCCGGTTG GACTCTGACA TCGGATGCCC TCAAACATAC AGAACTTCCA 1201 AACTCAAGTC CAGCCATAAG CTATTTTGCC AACATGTCAG AGTAATCTGT ATTTTTGTAT 1261 GTGATTTCTA CTTTTATAGA CTTGTTTTAA AACAATACCC AACTTTCTTG TACAAAGTGG 1321 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1381 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1441 AATCTGGTAA TGTTGATAAT ACCCTACGCG TTAAGTCgac aatcaacctc tggattacaa 1501 aatttgtgaa agatt