Transcript: Human XM_017009753.1

PREDICTED: Homo sapiens S-phase kinase associated protein 2 (SKP2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SKP2 (6502)
Length:
1277
CDS:
531..1256

Additional Resources:

NCBI RefSeq record:
XM_017009753.1
NBCI Gene record:
SKP2 (6502)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017009753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315078 AGTCGGTGCTATGATATAATA pLKO_005 1050 CDS 100% 15.000 21.000 N SKP2 n/a
2 TRCN0000007534 GATAGTGTCATGCTAAAGAAT pLKO.1 978 CDS 100% 5.625 7.875 N SKP2 n/a
3 TRCN0000315077 GATAGTGTCATGCTAAAGAAT pLKO_005 978 CDS 100% 5.625 7.875 N SKP2 n/a
4 TRCN0000007530 GCCTAAGCTAAATCGAGAGAA pLKO.1 387 5UTR 100% 4.950 6.930 N SKP2 n/a
5 TRCN0000350486 GCCTAAGCTAAATCGAGAGAA pLKO_005 387 5UTR 100% 4.950 6.930 N SKP2 n/a
6 TRCN0000007531 CCACGATCATTTATGGACCAA pLKO.1 519 5UTR 100% 2.640 3.696 N SKP2 n/a
7 TRCN0000350487 TTCCGCTGCCCACGATCATTT pLKO_005 510 5UTR 100% 13.200 10.560 N SKP2 n/a
8 TRCN0000007532 CCATTGTCAATACTCTCGCAA pLKO.1 685 CDS 100% 2.640 2.112 N SKP2 n/a
9 TRCN0000088761 GCAAGACTTCTGAACTGCTAT pLKO.1 215 5UTR 100% 4.950 3.465 N Skp2 n/a
10 TRCN0000302320 GCAAGACTTCTGAACTGCTAT pLKO_005 215 5UTR 100% 4.950 3.465 N Skp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017009753.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01538 pDONR223 100% 58.7% 58.7% None 0_1ins507 n/a
2 ccsbBroad304_01538 pLX_304 0% 58.7% 58.7% V5 0_1ins507 n/a
3 TRCN0000481076 ATCTGGTAATGTTGATAATACCCT pLX_317 35.9% 58.7% 58.7% V5 0_1ins507 n/a
4 TRCN0000492341 ACCGGATCCCGAGACATATGATCT pLX_317 29.1% 58.7% 58.7% V5 (not translated due to prior stop codon) 0_1ins507 n/a
5 TRCN0000489546 CCGTCCCTATGTCACTGCTATTAC pLX_317 30.7% 49.2% 44.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV