Construct: ORF TRCN0000481089
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004757.1_s317c1
- Derived from:
- ccsbBroadEn_11751
- DNA Barcode:
- TAGCCACACGAATGGAGTTATAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ELP5 (23587)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481089
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23587 | ELP5 | elongator acetyltransferase... | NM_015362.4 | 94.8% | 94.6% | 1_48del;907G>T |
| 2 | human | 23587 | ELP5 | elongator acetyltransferase... | NM_203414.2 | 94.8% | 94.6% | 1_48del;907G>T |
| 3 | human | 23587 | ELP5 | elongator acetyltransferase... | NM_203415.2 | 94.8% | 94.6% | 1_48del;907G>T |
| 4 | human | 23587 | ELP5 | elongator acetyltransferase... | XM_011523779.2 | 94.8% | 94.6% | 1_48del;907G>T |
| 5 | human | 23587 | ELP5 | elongator acetyltransferase... | NM_203413.2 | 76.5% | 70.7% | (many diffs) |
| 6 | human | 23587 | ELP5 | elongator acetyltransferase... | NR_145515.1 | 55.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 966
- ORF length:
- 900
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt ggactcgctg ttggccttgg gcggcctggt gctgcttcgg gattccgtgg 121 agtgggaggg gcgcagtctc ttgaaggcgc ttgtcaagaa atctgcactg tgtggggagc 181 aagtgcatat cctgggctgt gaagtgagcg aggaagagtt tcgtgaaggt tttgactctg 241 atatcaacaa tcggctggtt taccatgact tcttcagaga ccctctcaac tggtcaaaaa 301 ctgaggaggc ctttcctggg gggccgctgg gagccttgag agccatgtgc aagaggacag 361 atcctgttcc tgtcaccatt gctctcgatt cactcagctg gctgctactt cgccttccct 421 gcaccacact ctgccaggtc ctgcatgctg tgagccatca ggactcttgt cctggtgaca 481 gctccTCAGT GGGGAAAGTG AGTGTGCTGG GCTTGCTACA TGAAGAGCTT CATGGACCAG 541 GCCCTGTGGG AGCTCTCAGC AGCCTTGCTC AGACTGAGGT GACCCTGGGC GGTACCATGG 601 GCCAGGCCTC GGCCCACATC CTGTGTCGGA GGCCCCGACA GCGCCCAACT GACCAGACTC 661 AGTGGTTCTC CATCCTTCCG GACTTCAGCC TGGATCTCCA AGAGGGGCCC TCTGTAGAGT 721 CCCAGCCCTA CTCCGATCCT CATATACCCC CGGTGGATCC CACAACTCAT TTGACCTTTA 781 ACCTTCACCT GTCCAAGAAA GAGAGAGAAG CCAGAGATAG CCTGATCCTG CCCTTCCAGT 841 TCAGTTCTGA AAAACAGCAG GCTCTCCTGC GGCCTAGGCC AGGGCAGGCT ACCAGCCACA 901 TCTTCTATGA GCCAGATGCT TATTATGACC TGGACCAAGA AGACCCAGAT GACGACCTGG 961 ATATTTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1021 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1081 CTTGGCTTTA TATATTTGTG GAAAGGACGA TAGCCACACG AATGGAGTTA TAGCACGCGT 1141 TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt