Transcript: Human NM_203414.2

Homo sapiens elongator acetyltransferase complex subunit 5 (ELP5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
ELP5 (23587)
Length:
1525
CDS:
303..1253

Additional Resources:

NCBI RefSeq record:
NM_203414.2
NBCI Gene record:
ELP5 (23587)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128843 GATATCAACAATCGGCTGGTT pLKO.1 525 CDS 100% 2.640 2.112 N ELP5 n/a
2 TRCN0000130483 GCCCAGAACCATCTTTCTATT pLKO.1 1305 3UTR 100% 13.200 9.240 N ELP5 n/a
3 TRCN0000280598 GCCCAGAACCATCTTTCTATT pLKO_005 1305 3UTR 100% 13.200 9.240 N ELP5 n/a
4 TRCN0000130801 GCTACCAGCCACATCTTCTAT pLKO.1 1173 CDS 100% 5.625 3.938 N ELP5 n/a
5 TRCN0000130151 CCCACAACTCATTTGACCTTT pLKO.1 1044 CDS 100% 4.950 3.465 N ELP5 n/a
6 TRCN0000280600 CCCACAACTCATTTGACCTTT pLKO_005 1044 CDS 100% 4.950 3.465 N ELP5 n/a
7 TRCN0000127641 CCTGTCCAAGAAAGAGAGAGA pLKO.1 1073 CDS 100% 2.640 1.848 N ELP5 n/a
8 TRCN0000127864 GCCAGATGCTTATGATGACCT pLKO.1 1196 CDS 100% 2.640 1.848 N ELP5 n/a
9 TRCN0000130802 GCTTATGATGACCTGGACCAA pLKO.1 1203 CDS 100% 2.640 1.848 N ELP5 n/a
10 TRCN0000280661 GCTTATGATGACCTGGACCAA pLKO_005 1203 CDS 100% 2.640 1.848 N ELP5 n/a
11 TRCN0000127506 CCACATCTTCTATGAGCCAGA pLKO.1 1181 CDS 100% 2.160 1.512 N ELP5 n/a
12 TRCN0000343049 CCACATCTTCTATGAGCCAGA pLKO_005 1181 CDS 100% 2.160 1.512 N ELP5 n/a
13 TRCN0000216725 CTTCTATGAGCCAGATGCTTT pLKO.1 1187 CDS 100% 4.950 2.970 N Elp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11751 pDONR223 100% 94.8% 94.6% None 1_48del;907G>T n/a
2 ccsbBroad304_11751 pLX_304 0% 94.8% 94.6% V5 1_48del;907G>T n/a
3 TRCN0000481089 TAGCCACACGAATGGAGTTATAGC pLX_317 53.3% 94.8% 94.6% V5 1_48del;907G>T n/a
Download CSV