Construct: ORF TRCN0000481124
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002129.1_s317c1
- Derived from:
- ccsbBroadEn_11129
- DNA Barcode:
- CCTGACAGCATTTAGATCGGACCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SH3GL2 (6456)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481124
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6456 | SH3GL2 | SH3 domain containing GRB2 ... | NM_003026.5 | 79.1% | 78.9% | 517A>G;838_1056del |
| 2 | human | 6456 | SH3GL2 | SH3 domain containing GRB2 ... | XM_011518005.3 | 69.9% | 68% | (many diffs) |
| 3 | human | 6456 | SH3GL2 | SH3 domain containing GRB2 ... | XR_001746364.2 | 6.5% | (many diffs) | |
| 4 | mouse | 20404 | Sh3gl2 | SH3-domain GRB2-like 2 | NM_019535.2 | 71.1% | 78.4% | (many diffs) |
| 5 | mouse | 20404 | Sh3gl2 | SH3-domain GRB2-like 2 | XM_006537710.2 | 61.9% | 68.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 903
- ORF length:
- 837
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggtggccggc ctcaagaagc agttccataa agccactcag aaagtgagtg 121 agaaggttgg aggagctgaa ggaaccaagc tagatgatga cttcaaagag atggaaagga 181 aagtggatgt caccagcagg gctgtgatgg aaataatgac taaaacaatt gaataccttc 241 aacccaatcc agcttccaga gctaagctca gcatgatcaa caccatgtca aaaatccgtg 301 gccaggagaa ggggccaggc tatcctcagg cagaggcgct gctggcagag gccatgctca 361 aatttggaag agagcttgga gatgattgca actttggccc agcacttggt gaggtcgggg 421 aggccatgcg ggaactgtcg gaggtcaaag actctttgga catagaagtg aagcagaact 481 tcattgaccc tcttcagaat cttcatgaca aagatcttag ggaaattcaa caTCATCTAA 541 AGAAGTTGGA GGGTCGACGC CTGGATTTTG ATTATAAGAA GGAACGACAA GGCAAGATTC 601 CGGATGAAGA GCTTCGTCAA GCTCTAGAGA AATTTGATGA GTCTAAGGAA ATTGCTGAGT 661 CAAGCATGTT CAATCTCTTG GAGATGGATA TTGAACAAGT GAGCCAGCTC TCTGCACTTG 721 TGCAAGCTCA GCTGGAGTAC CACAAGCAGG CAGTCCAGAT CCTGCAGCAA GTCACGGTCA 781 GACTGGAAGA AAGAATAAGA CAGGCTTCAT CTCAGCCTAG AAGGGAATAT CAACCTAAAC 841 CACGAATGAG CCTGGAGTTT CCAACTGGAG ACAGTACTCA GCCCAATGGG GGTCTCTCCC 901 ACTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 961 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1021 GGCTTTATAT ATCTTGTGGA AAGGACGACC TGACAGCATT TAGATCGGAC CAACGCGTTA 1081 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt