Transcript: Human XM_011518005.3

PREDICTED: Homo sapiens SH3 domain containing GRB2 like 2, endophilin A1 (SH3GL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH3GL2 (6456)
Length:
9872
CDS:
7333..8493

Additional Resources:

NCBI RefSeq record:
XM_011518005.3
NBCI Gene record:
SH3GL2 (6456)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011518005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162090 CTGTACGACTTTGAACCTGAA pLKO.1 8326 CDS 100% 4.050 5.670 N SH3GL2 n/a
2 TRCN0000162418 CCCACCGAAGATATTGTCTAT pLKO.1 8817 3UTR 100% 4.950 3.960 N SH3GL2 n/a
3 TRCN0000093449 GCCCTCAATGAGGACCAAATA pLKO.1 9493 3UTR 100% 13.200 9.240 N Sh3gl2 n/a
4 TRCN0000165642 GCCCTCAATGAGGACCAAATA pLKO.1 9493 3UTR 100% 13.200 9.240 N SH3GL2 n/a
5 TRCN0000165717 CCAAACCTTCAGGTGTCCAAA pLKO.1 8282 CDS 100% 4.950 3.465 N SH3GL2 n/a
6 TRCN0000159481 CGATATCATCACACTCACTAA pLKO.1 8376 CDS 100% 4.950 3.465 N SH3GL2 n/a
7 TRCN0000160062 CTGTGATGGAAATAATGACTA pLKO.1 7571 CDS 100% 4.950 3.465 N SH3GL2 n/a
8 TRCN0000165007 GCTGAAGGAACCAAGCTAGAT pLKO.1 7504 CDS 100% 4.950 3.465 N SH3GL2 n/a
9 TRCN0000161678 GCATGTTCAATCTCTTGGAGA pLKO.1 8033 CDS 100% 2.640 1.848 N SH3GL2 n/a
10 TRCN0000159514 CCCATCAATTATGTGGAAATT pLKO.1 8452 CDS 100% 13.200 7.920 N SH3GL2 n/a
11 TRCN0000379433 GATATCATCACACTCACTAAT pLKO_005 8377 CDS 100% 13.200 18.480 N Sh3gl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011518005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11129 pDONR223 100% 69.9% 68% None (many diffs) n/a
2 ccsbBroad304_11129 pLX_304 0% 69.9% 68% V5 (many diffs) n/a
3 TRCN0000481124 CCTGACAGCATTTAGATCGGACCA pLX_317 44.4% 69.9% 68% V5 (many diffs) n/a
Download CSV