Construct: ORF TRCN0000481132
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016462.1_s317c1
- Derived from:
- ccsbBroadEn_11964
- DNA Barcode:
- CATTTGACACAATCTCGTGGTCCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- NUSAP1 (51203)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481132
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_001243142.2 | 100% | 100% | |
| 2 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_001301136.2 | 99.7% | 99.7% | 656_658delAGC |
| 3 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_018454.8 | 99.7% | 99.7% | 304_306delCAG |
| 4 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_016359.5 | 99.5% | 99.5% | 304_306delCAG;659_661delAGC |
| 5 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_005254428.3 | 98.4% | 98.4% | 304_306delCAG;448_465del |
| 6 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720560.4 | 98.4% | 98.4% | 445_462del;674_676delAGC |
| 7 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720559.3 | 98.2% | 98.2% | 304_306delCAG;448_465del;677_679delAGC |
| 8 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_005254430.5 | 96.8% | 96.8% | 303_304ins42 |
| 9 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_001243143.2 | 96.5% | 96.5% | 303_304ins42;614_616delAGC |
| 10 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720561.3 | 95.2% | 95.2% | 303_304ins42;403_420del;632_634delAGC |
| 11 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720563.3 | 90.9% | 90.9% | 304_306delCAG;1002_1003ins117 |
| 12 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_005254431.3 | 89.6% | 89.6% | 304_306delCAG;448_465del;1020_1021ins117 |
| 13 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_006720562.3 | 89.4% | 89.4% | (many diffs) |
| 14 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_017022294.2 | 87.9% | 87.9% | 303_304ins42;957_958ins117 |
| 15 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | NM_001243144.2 | 85.6% | 85.6% | 92_93ins69;235_237delCAG;933_934ins117 |
| 16 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XM_017022295.1 | 55.6% | 55.6% | 0_1ins582;74_76delAGC |
| 17 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XR_001751299.2 | 51.6% | (many diffs) | |
| 18 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XR_001751300.2 | 50% | (many diffs) | |
| 19 | human | 51203 | NUSAP1 | nucleolar and spindle assoc... | XR_001751301.2 | 45.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1383
- ORF length:
- 1317
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat catcccctct ctagaggagc tggactccct caagtacagt gacctgcaga 121 acttagccaa gagtctgggt ctccgggcca acctgagggc aaccaagttg ttaaaagcct 181 tgaaaggcta cattaaacat gaggcaagaa aaggaaatga gaatcaggat gaaagtcaaa 241 cttctgcatc ctcttgtgat gagactgaga tacagatcag caaccaggaa gaagctgaga 301 gacagccact tggccatgtc accaaaacaa ggagaaggtg caagactgtc cgtgtggacc 361 ctgactcaca gaatcattca gagataaaaa taagtaatcc cactgaattc cagaatcatg 421 aaaagcagga aagccaggat ctcagagcta ctgcaaaagt tccttctcca ccagacgagc 481 accaagaagc tgagaatgct gtttcctcag gtaacagaga ttcaaaggta ccttcagaag 541 gaaagaaatc tctctacaca gatgagtcat ccaaacctgg aaaaaataaa agaactgcaa 601 tcactactcc aaactttaag aagcttcatg aagctcattt taaggaaatg gagtccattg 661 atcaatatat tgagagaaaa aagaaacatt ttgaagaaca caattccatg aatgaactga 721 agcagcccat caataaggga ggggtcagga ctccagtacc tccaagagga agactctctg 781 tggcttctac tcccatcagc caacgacgct cgcaaggccg gtcttgtggc cctgcaagtc 841 agagtacctt gggtctgaag gggtcactca agcgctctgc tatctctgca gctaaaacgg 901 GTGTCAGGTT TTCAGCTGCT ACTAAAGATA ATGAGCATAA GCGTTCACTG ACCAAGACTC 961 CAGCCAGAAA GTCTGCACAT GTGACCGTGT CTGGGGGCAC CCCAAAAGGC GAGGCTGTGC 1021 TTGGGACACA CAAATTAAAG ACCATCACGG GGAATTCTGC TGCTGTTATT ACCCCATTCA 1081 AGTTGACAAC TGAGGCAACG CAGACTCCAG TCTCCAATAA GAAACCAGTG TTTGATCTTA 1141 AAGCAAGTTT GTCTCGTCCC CTCAACTATG AACCACACAA AGGAAAGCTA AAACCATGGG 1201 GGCAATCTAA AGAAAATAAT TATCTAAATC AACATGTCAA CAGAATTAAC TTCTACAAGA 1261 AAACTTACAA ACAACCCCAT CTCCAGACAA AGGAAGAGCA ACGGAAGAAA CGCGAGCAAG 1321 AACGAAAGGA GAAGAAAGCA AAGGTTTTGG GAATGCGAAG GGGCCTCATT TTGGCTGAAG 1381 ATTAACCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1441 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1501 GGCTTTATAT ATCTTGTGGA AAGGACGACA TTTGACACAA TCTCGTGGTC CCACGCGTTA 1561 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt