Construct: ORF TRCN0000481167
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009147.1_s317c1
- Derived from:
- ccsbBroadEn_05921
- DNA Barcode:
- AAACCTCTTACATCTTATCGTATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CA5A (763)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481167
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 763 | CA5A | carbonic anhydrase 5A | NM_001739.2 | 99.7% | 100% | 453C>T;807A>T |
| 2 | human | 763 | CA5A | carbonic anhydrase 5A | NM_001367225.1 | 89.1% | 85.1% | (many diffs) |
| 3 | human | 763 | CA5A | carbonic anhydrase 5A | XM_017023646.1 | 82.9% | 83.5% | (many diffs) |
| 4 | human | 763 | CA5A | carbonic anhydrase 5A | NR_159798.1 | 74.7% | (many diffs) | |
| 5 | human | 763 | CA5A | carbonic anhydrase 5A | NR_159799.1 | 71.4% | (many diffs) | |
| 6 | human | 763 | CA5A | carbonic anhydrase 5A | XM_011523309.2 | 70.5% | 53.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 984
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gttggggagg aacacttgga agacctcagc tttctccttc ttggttgagc 121 agatgtgggc ccctctctgg agtcgttcga tgaggccagg gcgatggtgt tctcagcgtt 181 cctgtgcatg gcaaaccagc aataacactt tgcacccact ctggacggtc ccggtctccg 241 tgccaggggg cacccggcag tctcctatta acatccagtg gagggacagc gtctatgacc 301 cccagctgaa gccactcagg gtctcctatg aagcggcatc ctgcctgtac atctggaaca 361 ctggctacct cttccaggtg gaatttgacg atgccaccga ggcatcagga attagtggtg 421 ggcccttgga aaaccactac agactgaagc aatttcactt ccactgggga gcagtgaacg 481 aggggggctc agagcacaca gtggacggcc acgcgtaccc tgcagagctg catttagttc 541 actggaattc tgtgaaatac caaaattaCA AGGAAGCTGT CGTGGGAGAG AATGGTTTGG 601 CTGTGATAGG CGTGTTTTTA AAGCTCGGGG CCCATCATCA GACGCTGCAG AGGCTGGTGG 661 ACATCTTGCC GGAAATAAAA CATAAGGACG CGCGGGCGGC CATGCGCCCC TTCGACCCCT 721 CCACTCTGCT GCCCACCTGC TGGGATTACT GGACCTACGC GGGCTCGCTC ACCACCCCGC 781 CGCTGACCGA GTCGGTCACC TGGATCATCC AGAAGGAGCC CGTTGAAGTG GCCCCAAGCC 841 AGCTCTCTGC ATTTCGTACT CTCCTGTTTT CTGCTCTTGG TGAAGAGGAG AAGATGATGG 901 TGAACAACTA TCGCCCACTT CAACCCTTGA TGAACCGGAA GGTCTGGGCG TCCTTCCAGG 961 CCACTAATGA GGGCACAAGG TCCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1021 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1081 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA AACCTCTTAC 1141 ATCTTATCGT ATTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1201 att